spoVT

spoVT
168

transcription activator and repressor of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]-dependent genes

locus
BSU_00560
Molecular weight
19.60 kDa
pI
4.68
Protein length
Gene length
function
regulation of forespore gene expression
product
transcriptional regulator
essential
no
synonyms
spoVT, yabL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5845

This gene is a member of the following regulons

Gene
Coordinates
64,099 64,635
The protein
[wiki|Domains]
[wiki|SpoVT-AbrB domain] (aa 5-51) (according to UniProt)
Structure
[PDB|2W1R] (full-length), [PDB|2W1T] (C-terminal domain) [PDB|2RO5] (recognition domain)
[AF|P37554]
Paralogous protein(s)
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]
[protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh], (only the N-terminal domains (aa 1 through 50) are conserved between SpoVT and the two paralogues)
[wiki|Localization]
Cytoplasm (Homogeneous) [Pubmed|16479537]
Expression and Regulation
Operons
genes
[gene|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]
description
[Pubmed|8755877]
regulation
expressed in the forespore ([protein|search|SigG]) [Pubmed|8755877]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,8755877], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]

2022-11-27 08:13:16

ghost

32

d0a057146fbbb33c28d4b0113075f13ed655b08a

5954F73A28717D648B582825BFA83B9E497F2487

genes
[gene|C595D32D98723E93AF26B5C864FD61AF4739E069|fin]-[gene|AD1F39823ABCE2A222259B879513752942C59590|mfd]-[gene|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]
description
[pubmed|22383849]
expression
expression is heterogeneous [pubmed|35171018]
Open in new tab

[gene|C595D32D98723E93AF26B5C864FD61AF4739E069|fin]→[gene|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]

2022-11-23 03:41:08

Jstuelk

49

24843A2E745DD5C1C92792486D51FED74A35A094

F1FF2D64FF9C8F7A797DEED100A7732A06763FB4

Biological materials
Mutant
BKE00560 ([gene|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTGGTGCCTCTCTTT, downstream forward: _UP4_TAGGTCTTATTCCTTTCTTC
BKK00560 ([gene|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTGGTGCCTCTCTTT, downstream forward: _UP4_TAGGTCTTATTCCTTTCTTC
References
Reviews
31350897,35638784
Original Publications
16497325,18996130,15063493,8755877,16479537,16159768,22522895,15980461,27790204

01EF886D3D004EA9B22AC5E75D50FF07D8631E68

Page visits: 2756

Time of last update: 2022-12-01 07:24:28

Author of last update: Jstuelk