yobN

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yobN
168

similar to L-amino acid oxidase

locus
BSU_19020
Molecular weight
50.47 kDa
pI
7.04
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
1.4.3.2
synonyms
yobN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1231

This gene is a member of the following regulons

Gene
Coordinates
2,074,439  2,075,779
The protein
Catalyzed reaction/ biological activity
L-α-amino acid + H2O + O2 --> 2-oxocarboxylate + H2O2 + NH4+(according to UniProt)
Protein family
flavin monoamine oxidase family (single member, according to UniProt)
[wiki|Cofactors]
FAD (according to UniProt)
Structure
[PDB|3KVE] (from Vipera ammodytes 35% identity)
[AF|O34363]
Expression and Regulation
Operons
genes
[gene|02269068E6E4282A32BB5AE0FAE27F104202E5B5|yobN]-[gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]
description
[Pubmed|22383849]
Open in new tab

[gene|02269068E6E4282A32BB5AE0FAE27F104202E5B5|yobN]→[gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]

2022-05-13 02:31:49

Jstuelk

11

b628234fd1c0bafea9a08a35b9b11325225556e6

47035438C5C3A58C65B47CD063E27B8C43424E26

Biological materials
Mutant
MGNA-A311 (yobN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/311 NBRP B. subtilis, Japan]
BKE19020 ([gene|02269068E6E4282A32BB5AE0FAE27F104202E5B5|yobN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTTTTGGAGGCACCTCT,  downstream forward: _UP4_TAGATCATGCTCACATCTTG
BKK19020 ([gene|02269068E6E4282A32BB5AE0FAE27F104202E5B5|yobN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTTTTGGAGGCACCTCT,  downstream forward: _UP4_TAGATCATGCTCACATCTTG
References
35185199

02269068E6E4282A32BB5AE0FAE27F104202E5B5

Page visits: 1145

Time of last update: 2022-05-19 18:46:49

Author of last update: Jstuelk