yisI

yisI
168

[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]-P phosphatase, control of the [wiki|phosphorelay]

locus
BSU_10730
Molecular weight
6.54 kDa
pI
5.12
Protein length
Gene length
function
control of [wiki|sporulation] initiation
product
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]-P phosphatase
essential
no
synonyms
yisI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5804

This gene is a member of the following regulons

Gene
Coordinates
1,150,850  1,151,020
The protein
Protein family
spo0E family (with [protein|search|ynzd ]and [protein|A574974B6F4FF46DC69E03AE021651C67089866F|spo0E], according to UniProt)
Structure
[PDB|2C0S] (from B. anthracis, corresponds to aa 1 ... 41 of YisI, 44% identity) [pubmed|17001075]
[AF|O06722]
Expression and Regulation
Operons
genes
[gene|022933D89666CDD2ACE39BCBB78D349BAF8E899B|yisI]
description
[pubmed|22383849]
regulatory mechanism
[protein|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]: activation, in [regulon|protein:0D555F2AB7DC863E6FF388888308E980514DB719|pchR regulon]
Open in new tab

[gene|022933D89666CDD2ACE39BCBB78D349BAF8E899B|yisI]

2022-11-20 01:34:20

Bzhu

17

fda5be43a89a91f765093cf25c036e1af90cb667

CF24310E73FA254A6856AF84B57F033F65E3D96C

genes
[gene|75FBA935A39AF67DB4E69C8699D29D9F5C149143|yisJ]-[gene|022933D89666CDD2ACE39BCBB78D349BAF8E899B|yisI]
description
[Pubmed|22383849]
regulation
induced during [wiki|sporulation] [Pubmed|22383849]
strongly expressed during oligotrophic growth [pubmed|30792386]
Open in new tab

[gene|75FBA935A39AF67DB4E69C8699D29D9F5C149143|yisJ]→[gene|022933D89666CDD2ACE39BCBB78D349BAF8E899B|yisI]

2022-11-28 22:22:38

Jstuelk

28

18eaafff5ebacbe5d56a2b237c67bd184de995ac

E5AF07964DB70D6E54E39B684BEE1F16D0838363

Biological materials
Mutant
BKE10730 ([gene|022933D89666CDD2ACE39BCBB78D349BAF8E899B|yisI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10730 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACGCTATCTCCAATTC,  downstream forward: _UP4_TAAATCATTTTCTATAACAA
BKK10730 ([gene|022933D89666CDD2ACE39BCBB78D349BAF8E899B|yisI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10730 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACGCTATCTCCAATTC,  downstream forward: _UP4_TAAATCATTTTCTATAACAA
References
11679073,20525796,27542896,17001075

022933D89666CDD2ACE39BCBB78D349BAF8E899B

Page visits: 3053

Time of last update: 2022-12-01 09:36:15

Author of last update: Melvin.boenninger