yczH

yczH
168

unknown

locus
BSU_04020
Molecular weight
20.93 kDa
pI
8.89
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yczH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0412

This gene is a member of the following regulons

Gene
Coordinates
454,652  455,260
The protein
Protein family
dienelactone hydrolase family (with [protein|19B1345F36B2320F0714B8EF1B939C65FA7E382D|ytaP], according to UniProt)
Structure
[PDB|1ZI6] (Carboxymethylenebutenolidase from Pseudomonas putida, corresponds to aa 3 ... 123, 23.9%) [pubmed|15983415]
[AF|O31482]
Expression and Regulation
Operons
genes
[gene|025BB89AF2AAAC5BCF780A7FE0E23042E85BB743|yczH]
description
[pubmed|22383849]
Open in new tab

[gene|025BB89AF2AAAC5BCF780A7FE0E23042E85BB743|yczH]

2022-11-28 19:14:11

Jstuelk

9

452716a3bdaaef72ff9db6c962e892a25bd6d1d3

714F81766E6353EA74E8C87BC26EE8D92A603149

Biological materials
Mutant
MGNA-C070 (yczH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2068 NBRP B. subtilis, Japan]
BKE04020 ([gene|025BB89AF2AAAC5BCF780A7FE0E23042E85BB743|yczH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACGGCCTCCTTTTGTG,  downstream forward: _UP4_TAAACGTGCACGGCGCTTTA
BKK04020 ([gene|025BB89AF2AAAC5BCF780A7FE0E23042E85BB743|yczH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACGGCCTCCTTTTGTG,  downstream forward: _UP4_TAAACGTGCACGGCGCTTTA
References
Research papers
15983415

025BB89AF2AAAC5BCF780A7FE0E23042E85BB743

Page visits: 764

Time of last update: 2022-11-30 13:09:35

Author of last update: Jstuelk