pdeH

pdeH
168

c-di-GMP degrading phosphodiesterase

locus
BSU_31740
Molecular weight
47.76 kDa
pI
5.36
Protein length
Gene length
function
degradation of c-di-GMP
product
c-di-GMP degrading phosphodiesterase
essential
no
ec
3.1.3.71
synonyms
pdeH, yuxH, comB, yufA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3434

This gene is a member of the following regulons

Gene
Coordinates
3,258,037  3,259,266
Phenotypes of a mutant
about three-fold increase of intracellular levels of c-di-GMP [pubmed|31138629]
defective in [category|SW.4.1.4|Swarming] motility [pubmed|35638827]
The protein
Catalyzed reaction/ biological activity
degradation of c-di-GMP [Pubmed|23893111]
[wiki|Domains]
contains an EAL domain [Pubmed|22821967]
EAL domain (aa 1-209) (according to UniProt)
HDOD domain (aa 203-392) (according to UniProt)
Structure
[AF|P14203]
Expression and Regulation
Operons
genes
[gene|02628F274952F9AEEE9F2224B771A4CE4AAD1C8D|pdeH]
description
[Pubmed|2507523]
regulation
repressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647,15687200]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2507523], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|02628F274952F9AEEE9F2224B771A4CE4AAD1C8D|pdeH]

2022-12-04 07:14:10

ghost

20

0cca1daa90501eb65c800cc1be30dcc1a7e1d26a

C8B03734459108EF34B23B097DA617A6DC82AB88

Biological materials
Mutant
MGNA-A606 (yufA/yuxH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/606 NBRP B. subtilis, Japan]
GP1590 (kan) available in [wiki|Jörg Stülke]'s lab
BKE31740 ([gene|02628F274952F9AEEE9F2224B771A4CE4AAD1C8D|pdeH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGATTTATCCCCCTTAC,  downstream forward: _UP4_TATTTAGAGGCTCTGGAATG
BKK31740 ([gene|02628F274952F9AEEE9F2224B771A4CE4AAD1C8D|pdeH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGATTTATCCCCCTTAC,  downstream forward: _UP4_TATTTAGAGGCTCTGGAATG
References
14651647,15687200,2507523,22821967,23893111,31138629,35638827

02628F274952F9AEEE9F2224B771A4CE4AAD1C8D

Page visits: 2794

Time of last update: 2022-12-04 04:57:14

Author of last update: Jstuelk