yjiC

yjiC
168

UDP-dependent glycosyltransferase, macrolide glycosyltransferase

locus
BSU_12220
Molecular weight
43.83 kDa
pI
4.65
Protein length
Gene length
function
synthesis of bacillaene
product
UDP-dependent macrolide glycosyltransferase
essential
no
synonyms
yjiC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1819

This gene is a member of the following regulons

Gene
Coordinates
1,292,557  1,293,735
The protein
Protein family
UDP-glycosyltransferase family (with [protein|BD82663B1BF2763D2D2DE710C2896E4155419324|ydhE] and [protein|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|yojK], according to UniProt)
Structure
[PDB|2IYA] (from Streptomyces antibioticus, 37% identity) [pubmed|17376874]
[AF|O34539]
Expression and Regulation
Operons
genes
[gene|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|yjiB]-[gene|02927D2CC9F44B99DB307DDFED2DD52DE2196120|yjiC]
description
[pubmed|22383849]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [pubmed|26577401]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [pubmed|26577401], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|yjiB]→[gene|02927D2CC9F44B99DB307DDFED2DD52DE2196120|yjiC]

2022-11-23 23:21:56

Bzhu

16

073ca9aab3a275bafb07ea42fde41a1b706dbaf1

F14DB3BDD2C8B1F267255CF70BF3CF87D33EB8C7

Biological materials
Mutant
MGNA-A345 (yjiC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/345 NBRP B. subtilis, Japan]
BKE12220 ([gene|02927D2CC9F44B99DB307DDFED2DD52DE2196120|yjiC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE12220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATCTCCAGTCTCCTT,  downstream forward: _UP4_TAAAAACATAAAAACCGAAA
BKK12220 ([gene|02927D2CC9F44B99DB307DDFED2DD52DE2196120|yjiC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK12220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATCTCCAGTCTCCTT,  downstream forward: _UP4_TAAAAACATAAAAACCGAAA
References
25354260,28315700,17376874,29338263,31726169,31786106,33310191

02927D2CC9F44B99DB307DDFED2DD52DE2196120

Page visits: 2369

Time of last update: 2022-12-01 09:40:54

Author of last update: Jstuelk