lysA

lysA
168

diaminopimelate decarboxylase

locus
BSU_23380
Molecular weight
48.41 kDa
pI
5.01
Protein length
Gene length
function
biosynthesis of lysine
product
diaminopimelate decarboxylase
essential
no
ec
4.1.1.20
synonyms
lysA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0019

This gene is a member of the following regulons

Gene
Coordinates
2,436,947 → 2,438,266
Phenotypes of a mutant
auxotrophic for lysine [Pubmed|15574923]
reduced conjugation of ICEBs1 [Pubmed|25069588]
The protein
Catalyzed reaction/ biological activity
H+ + meso-2,6-diaminopimelate --> CO2 + L-lysine (according to UniProt)
Protein family
Orn/Lys/Arg decarboxylase class-II family (single member, according to UniProt)
[wiki|Cofactors]
PLP (according to UniProt)
Structure
[PDB|1HKW] (from ''Mycobacterium tuberculosis'', 42% identity, 61% similarity) [Pubmed|12637582]
[AF|P23630]
Expression and Regulation
Operons
genes
[gene|5410018998EC9792A69CF0D9C438EEF5AC8A82C5|spoVAA]-[gene|AEC70413BDC29F435776D532E7049AA9A0BD893D|spoVAB]-[gene|B280951A232E941FB0A6C8834049765BE1E16437|spoVAC]-[gene|9531F0A0DC4AE5696FFBAC9C2A773F15840E3255|spoVAD]-[gene|31D6CB7EC20C39C1815CA4552B8B9C4BE304E86B|spoVAEB]-[gene|B44529B69769D7AF1010E06C95E398EA91A3E798|spoVAEA]-[gene|CBE5093DFBBCE25071CCE12408BC9AFF7A158C03|spoVAF]-[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]
description
[Pubmed|7934830]
regulation
expressed late during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG], [wiki|SpoVT]) [Pubmed|15699190,1903432,8755877]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: activation, [Pubmed|8755877], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,1903432], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|5410018998EC9792A69CF0D9C438EEF5AC8A82C5|spoVAA]→[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]

2022-12-03 09:54:38

Jstuelk

27

12fce0add6fb0abbed0128cd99d7be2c377e96d5

420F73950DA10EFCB3126E84B350E66BA95D34DD

genes
[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]
description
[pubmed|22383849]
Open in new tab

[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]

2022-11-27 12:15:28

Jstuelk

17

d86e94834f2dae2dfcf9d695bd0ee6e466117994

9CBEAB013175E6509E509C5928AC6BC3DC05F000

Biological materials
Mutant
1A615 ( ''lysA''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A615&Search=1A615 BGSC]
BKE23380 (Δ[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTCATTCCCTCTTTCT,  downstream forward: _UP4_TAAAAGAAAGCGCCGATTTT
BKK23380 (Δ[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTCATTCCCTCTTTCT,  downstream forward: _UP4_TAAAAGAAAGCGCCGATTTT
References
7934830,15574923,15699190,1903432,8755877,25069588

02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD

Page visits: 2034

Time of last update: 2022-12-06 09:18:20

Author of last update: Melvin.boenninger