SubtiWiki SubtiWiki
yobO

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yobO
168

similar to phage-related pre-neck appendage protein

locus
BSU_19030
Molecular weight
87.55 kDa
pI
5.57
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yobO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,076,206  2,078,626
The protein
Structure
[PDB|3SUC] (from phage Phi29, 40% identity) [pubmed|19450535]
Expression and Regulation
Operons
genes
[gene|02269068E6E4282A32BB5AE0FAE27F104202E5B5|yobN]-[gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]
description
[Pubmed|22383849]
Open in new tab

[gene|02269068E6E4282A32BB5AE0FAE27F104202E5B5|yobN]→[gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]

2022-01-22 08:06:24

Jstuelk

4

b628234fd1c0bafea9a08a35b9b11325225556e6

47035438C5C3A58C65B47CD063E27B8C43424E26

genes
[gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]
description
[Pubmed|22383849]
regulation
subject to carbon catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [Pubmed|10666464]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]

2021-12-06 09:50:08

Jstuelk

3

2bef163bcba24ea6f000c4eabd0d9895963d829a

84850199853E0F1E834886BED4F06748019879A0

Biological materials
Mutant
MGNA-A312 (yobO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/312 NBRP B. subtilis, Japan]
BKE19030 ([gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAAGACACCTCTTT,  downstream forward: _UP4_TAGTGGATACGCCGACCAGT
BKK19030 ([gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAAGACACCTCTTT,  downstream forward: _UP4_TAGTGGATACGCCGACCAGT
References
20817675,10666464,19450535

032110CBA492D54F6494984323D12D719EAEAAD9

Page visits: 844

Time of last update: 2022-01-22 22:59:42

Author of last update: Jstuelk