vmlR

vmlR
168

F-type ATP-binding cassette protein, allosterically dissociates antibiotics (virginiamycin M, lincomycin) from their ribosomal binding sites

locus
BSU_05610
Molecular weight
62.57 kDa
pI
6.73
Protein length
Gene length
function
dissociation of antibiotics (virginiamycin M, lincomycin) from the ribosome
product
ABCF ATPase
essential
no
synonyms
vmlR, expZ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0488

This gene is a member of the following regulons

Gene
Coordinates
604,736  606,379
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|ABCF ATPase subfamily] [pubmed|30597160]
[wiki|Domains]
2 [wiki|ABC transporter domain]s (aa 5-200, aa 292-504) (according to UniProt)
Structure
[PDB|6HA8] [pubmed|30126986]
[AF|P39115]
[wiki|Localization]
cytoplasm [pubmed|30597160]
Expression and Regulation
Operons
genes
[gene|032BF9280D006DD6D7C7D07A983C95E1433AC88C|vmlR]
description
[Pubmed|16109936]
regulation
induced by virginiamycin M or lincomycin due to antibiotic-induced ribosome stalling during translation of an upstream open reading frame in the [gene|032BF9280D006DD6D7C7D07A983C95E1433AC88C|vmlR] leader region resulting in transcription anti termination [Pubmed|35699226,16109936]
[protein|43CFA3477B4EEB4CE0B2DF63ED2B5EDB171E79C7|nusG]-dependent RNA polymerase pausing in the [gene|032BF9280D006DD6D7C7D07A983C95E1433AC88C|vmlR] leader prevents leaky expression in the absence of antibiotic [pubmed|35699226]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16109936], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
A [protein|search|ncRNA] is predicted between '[protein|032BF9280D006DD6D7C7D07A983C95E1433AC88C|vmlR]' and '[protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|ydgF]' [PubMed|20525796]
Open in new tab

[gene|032BF9280D006DD6D7C7D07A983C95E1433AC88C|vmlR]

2022-11-29 22:14:40

Jstuelk

25

B7DCF7DC81ED468EC775E3B173B90CC44E7BFEE9

E139E30D1D62EF92041092E81380E011573FC208

Biological materials
Mutant
MGNA-C159 (expZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2157 NBRP B. subtilis, Japan]
BKE05610 ([gene|032BF9280D006DD6D7C7D07A983C95E1433AC88C|vmlR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCATATCCCTCGCTTTA,  downstream forward: _UP4_TGAGGGAGAAAGTTCAAGCG
BKK05610 ([gene|032BF9280D006DD6D7C7D07A983C95E1433AC88C|vmlR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCATATCCCTCGCTTTA,  downstream forward: _UP4_TGAGGGAGAAAGTTCAAGCG
References
Reviews
30746819
Original Publications
10092453,16109936,20525796,24687494,27120414,24389466,30126986,30597160,35699226

032BF9280D006DD6D7C7D07A983C95E1433AC88C

Page visits: 2725

Time of last update: 2022-12-05 13:48:08

Author of last update: Jstuelk