yabP

yabP
168

required for [wiki|sporulation] at a late stage

locus
BSU_00600
Molecular weight
11.26 kDa
pI
6.34
Protein length
Gene length
function
[wiki|sporulation]
product
unknown
essential
no
synonyms
yabP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5868

This gene is a member of the following regulons

Gene
Coordinates
68,216  68,518
The protein
Structure
[PDB|3IPF] (from Desulfitobacterium hafniense, 45% identity)
[AF|P37558]
[wiki|Localization]
forespore outer membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|D6B1837075ECBEE1FEAC704DDB6795336092897F|yabM]-[gene|52D48F22CB53421EE30970D34B4861E2F8A5893D|yabN]-[gene|B0CB19A3E3E84E12BF42BB050394C8A059A89359|rqcP]-[gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]-[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]-[gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
description
[Pubmed|11283287]
regulation
expressed during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]) [Pubmed|11283287]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,11283287], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|12207695], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|26577401], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|12207695], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|D6B1837075ECBEE1FEAC704DDB6795336092897F|yabM]→[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]

2022-11-22 17:48:11

Jstuelk

49

93952be38722510f984794e138450cd80a9f7d48

0CF3909333400A3BFE18E32016883124FFC3D75B

genes
[gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]-[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]-[gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
description
[Pubmed|11283287]
regulation
expressed during sporulation ([protein|search|SigE]) [Pubmed|11283287]
additional information
there are about 50,000 molecules of DivIC per cell [http://www.ncbi.nlm.nih.gov/sites/entrez/9426141 PubMed]
Open in new tab

[gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]→[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]

2022-11-26 18:07:17

ghost

34

adf8aab8f33a2b64c2ab3f1426fc15c0793898c5

4D8628337CAF16F8F83A7EEB7090199FCE86D5A2

Biological materials
Mutant
MGNA-B917 (yabP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1916 NBRP B. subtilis, Japan]
BKE00600 ([gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATTCAGCCCCCATAT,  downstream forward: _UP4_AAATGACGCTGACGACACAA
BKK00600 ([gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATTCAGCCCCCATAT,  downstream forward: _UP4_AAATGACGCTGACGACACAA
References
11283287,10869437,15231775,35638784

035B5486A3887FC71ACC0A8FB43ED77DC44E12EA

Page visits: 1624

Time of last update: 2022-11-27 07:04:40

Author of last update: Jstuelk