SubtiWiki SubtiWiki
yfiI

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yfiI
168

similar to oxidoreductase

locus
BSU_08280
Molecular weight
43.42 kDa
pI
5.1
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfiI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0673

This gene is a member of the following regulons

Gene
Coordinates
902,506  903,687
The protein
Protein family
[wiki|Gfo/Idh/MocA family] (according to UniProt)
Structure
[PDB|3DTY] (from Pseudomonas syringae, 56% identity)
Paralogous protein(s)
[protein|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC], [protein|484D17480DFAD3667E0EBC6D38854A7546A8DB46|yteT], [protein|7DFE74C751A67CCC84579D52005E1399B0A10166|iolW], [protein|920C5750CB95102B073C32874D512E8D636D2C7D|iolU], [protein|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG], [protein|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|yrbE], [protein|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX]
Expression and Regulation
Operons
genes
[gene|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG]-[gene|8DA8F976B846665FA9E6BD0FF86FE1F58CCFD260|yfiH]-[gene|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI]
description
[pubmed|22383849]
Open in new tab

[gene|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG]→[gene|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI]

2021-10-12 20:42:22

Jstuelk

6

b865cc31d96c5fe3ad5670cf06670a32d1d4026d

70B62AA6E1970EF89FAD5C55C8777685590D5044

Biological materials
Mutant
MGNA-C299 (yfiI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2297 NBRP B. subtilis, Japan]
BKE08280 ([gene|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCATTTAGCATCATGAAAA,  downstream forward: _UP4_TAAATGAGGGAATGCGCCGC
BKK08280 ([gene|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCATTTAGCATCATGAAAA,  downstream forward: _UP4_TAAATGAGGGAATGCGCCGC

03BE6DA854612B3F6741E0E167AB310F0DE96285

Page visits: 1031

Time of last update: 2022-01-05 20:53:51

Author of last update: Jstuelk