trpC

trpC
168

indole-3-glycerol-phosphate synthase

locus
BSU_22660
Molecular weight
27.69 kDa
pI
5.53
Protein length
Gene length
function
biosynthesis of tryptophan
product
indole-3-glycerol-phosphate synthase
essential
no
ec
4.1.1.48
synonyms
trpC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,374,139 → 2,374,888
The protein
Catalyzed reaction/ biological activity
1-(2-carboxyphenylamino)-1-deoxy-D-ribulose 5-phosphate + H+ --> (1S,2R)-1-C-(indol-3-yl)glycerol 3-phosphate + CO2 + H2O (according to UniProt)
Protein family
TrpC family (single member, according to UniProt)
Structure
[PDB|1VC4] (from ''Thermus thermophilus'', 36% identity, 49% similarity)
[AF|P03964]
Expression and Regulation
Operons
genes
[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]
description
[Pubmed|21815947]
regulation
not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: termination/antitermination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab

[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]→[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]

2022-11-27 04:01:30

Jstuelk

24

53eef6e8739e58d1bed57b78e584c86a2e6ff379

37D11B58C2266E362D5C193ADEA68D53F64A90E3

genes
[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
description
[Pubmed|21815947]
regulation
not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: termination/antitermination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab

[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]→[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]

2022-11-17 08:57:50

Jstuelk

29

a3b37416002f0f1e65847bd8d15ba18b53400752

AA88BDB7192FA5467301E36C102EEEBB21BEDA86

Biological materials
Mutant
BKE22660 (Δ[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCAAGCATAGATCTCTTC,  downstream forward: _UP4_CATGCTTTGTTTAGGGAGTG
BKK22660 (Δ[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCAAGCATAGATCTCTTC,  downstream forward: _UP4_CATGCTTTGTTTAGGGAGTG
References
Reviews
12966138
Original Publications
14976255,3924737,6436812,2422155,8419914,1551827,21815947

0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5

Page visits: 3126

Time of last update: 2022-11-29 07:07:39

Author of last update: Melvin.boenninger