SubtiWiki SubtiWiki
yecA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yecA
168

similar to L-methionine and branched chain amino acids transporter

locus
BSU_06550
Molecular weight
49.66 kDa
pI
8.91
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yecA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0531

This gene is a member of the following regulons

Gene
Coordinates
712,019  713,293
The protein
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
Structure
[PDB|6F34] (from Geobacillus kaustophilus, corresponds to aa 35 ... 317, 23% identity) [pubmed|29416041]
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
GP3039 Δ[gene|04FE8A07424F1FEFA7611BA4421087ED42E2D460|yecA]::''cat'', available in [wiki|Jörg Stülke]'s lab [pubmed|32743959]
MGNA-A909 (yecA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/909 NBRP B. subtilis, Japan]
BKE06550 ([gene|04FE8A07424F1FEFA7611BA4421087ED42E2D460|yecA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCCCCTCTCTGAT,  downstream forward: _UP4_GTTTTGTGATCAAGCTTTTC
BKK06550 ([gene|04FE8A07424F1FEFA7611BA4421087ED42E2D460|yecA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCCCCTCTCTGAT,  downstream forward: _UP4_GTTTTGTGATCAAGCTTTTC
References
26319875,29416041

04FE8A07424F1FEFA7611BA4421087ED42E2D460

Page visits: 1178

Time of last update: 2022-01-22 22:22:26

Author of last update: Jstuelk