ndoAI

ndoAI
168

antitoxin, antagonist for [protein|2E5A557E417CB355331CC0555D46A79793EB90B3|EndoA]

locus
BSU_04650
Molecular weight
10.41 kDa
pI
6.14
Protein length
Gene length
function
inhibition of [protein|2E5A557E417CB355331CC0555D46A79793EB90B3|EndoA]
product
antitoxin
essential
no
synonyms
ndoAI, ydcD, mazE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0864

This gene is a member of the following regulons

Gene
Coordinates
518,657  518,938
The protein
Protein family
mazE/ndoAI family (single member, according to UniProt)
Structure
[PDB|4ME7] ([protein|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]-[protein|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI] complex) [Pubmed|24120662]
[AF|P96621]
Expression and Regulation
Operons
genes
[gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]-[gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]
description
[Pubmed|15882409]
additional information
An [wiki|ncRNA] is predicted for '[protein|search|ndoA]' [PubMed|20525796]
Open in new tab

[gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]→[gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]

2022-11-21 00:33:55

ghost

13

7f8a7dc2f7eaf781e947a6a63979c438df7e04e3

5DFE68AF98CACE6494FDB04249DEF62EF29E68F8

genes
[gene|CB0B6C69CB5CFF6FE30C3F95991F309C8DE1E344|alr]-[gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]-[gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]
description
[pubmed|22383849]
Open in new tab

[gene|CB0B6C69CB5CFF6FE30C3F95991F309C8DE1E344|alr]→[gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]

2022-11-17 22:22:57

Jstuelk

22

91b7fa89916159e2bc7894e263572f1eeb4a5554

F1ED0F7D4D8E54352AA236431B9C138B1FC5ADBA

Biological materials
Mutant
BKE04650 ([gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAAACATACACCTCCAC,  downstream forward: _UP4_CGCTTAGTCAGCGGAGGATA
BKK04650 ([gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACCCCTTTTTCTCAATTG,  downstream forward: _UP4_TAACCGCCAAAGGCCAAACA
References
17416361,15882409,24120662,23736285

052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47

Page visits: 2080

Time of last update: 2022-11-27 03:55:57

Author of last update: Melvin.boenninger