oppD

oppD
168

oligopeptide [wiki|ABC transporter ](ATP-binding protein)

locus
BSU_11460
Molecular weight
39.61 kDa
pI
6.03
Protein length
Gene length
function
initiation of [wiki|sporulation], competence development
product
oligopeptide [wiki|ABC transporter ](ATP-binding protein)
essential
no
synonyms
oppD, spo0KD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0444

This gene is a member of the following regulons

Gene
Coordinates
1,223,455  1,224,531
The protein
Catalyzed reaction/ biological activity
required for the uptake of quorum sensing peptides such as [protein|4FA7D6E6316A6FC71C10C692D125833263894020|phrH] [Pubmed|21908671]
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 8-259) (according to UniProt)
Structure
[PDB|4FWI] (DppD from Caldanaerobacter subterraneus, 39% identity) [pubmed|23385461]
[AF|P24136]
Paralogous protein(s)
[protein|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD], [protein|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD], [protein|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]
[wiki|Localization]
attached to the cell membrane (via [protein|B0A3C7B253FB1DA1D4BC9D1D564905ECE8A65BC1|oppB]-[protein|DDBCE73B6AF39E5D669475479186C93F287DA9FC|oppC]) [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|302DFA46D73E18C4663468ED6033C55056744475|oppA]-[gene|B0A3C7B253FB1DA1D4BC9D1D564905ECE8A65BC1|oppB]-[gene|DDBCE73B6AF39E5D669475479186C93F287DA9FC|oppC]-[gene|05752B9C4EA7ACD579D65D028B7DF1861F3840CB|oppD]-[gene|38AD697B6C9967B8BD7496E31264A21F6D0A9DEE|oppF]
description
[Pubmed|1901616]
regulation
expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|12823818], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, no derepression occurs, however, in a [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY] mutant, due to increased repression by [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC] [Pubmed|25966844], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|10383984], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
additional information
A [protein|search|ncRNA] is predicted between '[protein|search|trpS]' and '[protein|search|oppA]' [PubMed|20525796]
Open in new tab

[gene|302DFA46D73E18C4663468ED6033C55056744475|oppA]→[gene|38AD697B6C9967B8BD7496E31264A21F6D0A9DEE|oppF]

2022-11-29 19:52:18

ghost

36

70070544ac18e9c940a824c6284e4ee6740ee2e5

E173E2B9FD2733A51C073CE2F9C6DE998F2580A2

Biological materials
Mutant
GP2097 (D(''[gene|302DFA46D73E18C4663468ED6033C55056744475|oppA]-[gene|B0A3C7B253FB1DA1D4BC9D1D564905ECE8A65BC1|oppB]-[gene|DDBCE73B6AF39E5D669475479186C93F287DA9FC|oppC]-[gene|05752B9C4EA7ACD579D65D028B7DF1861F3840CB|oppD]-[gene|38AD697B6C9967B8BD7496E31264A21F6D0A9DEE|oppF]'')::''aphA3''), available in [wiki|Jörg Stülke]'s lab
BKE11460 ([gene|05752B9C4EA7ACD579D65D028B7DF1861F3840CB|oppD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TAGGCGTGTCACCCGTATCA,  downstream forward: _UP4_GTCTTAGTGAGAGAAGTTGA
BKK11460 ([gene|05752B9C4EA7ACD579D65D028B7DF1861F3840CB|oppD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TAGGCGTGTCACCCGTATCA,  downstream forward: _UP4_GTCTTAGTGAGAGAAGTTGA
References
27231947,1901616,10092453,9252573,1899858,21908671,12823818,10383984,7997159,25966844,25755103,23385461

05752B9C4EA7ACD579D65D028B7DF1861F3840CB

Page visits: 3520

Time of last update: 2022-12-01 09:50:15

Author of last update: Melvin.boenninger