ypiA

ypiA
168

unknown

locus
BSU_22590
Molecular weight
48.16 kDa
pI
4.11
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ypiA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5010

This gene is a member of the following regulons

Gene
Coordinates
2,366,347  2,367,618
The protein
[wiki|Domains]
nine [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
Structure
[AF|P54389]
Expression and Regulation
Operons
genes
[gene|057BFF91609C918CEE4E6FF9100A1E4959BF6715|ypiA]-[gene|CDBBCB467FE9442B3CE45CF9401C609295E1B99F|reoY]
description
[Pubmed|22383849]
Open in new tab

[gene|057BFF91609C918CEE4E6FF9100A1E4959BF6715|ypiA]→[gene|CDBBCB467FE9442B3CE45CF9401C609295E1B99F|reoY]

2022-11-29 15:04:45

Jstuelk

13

4a0890814c10451867bc3c59ee4a82aa81eff6e8

585D8E9E9CD132F673A3DEF40B9A5AFA92A4E81F

Biological materials
Mutant
MGNA-A406 (ypiA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/406 NBRP B. subtilis, Japan]
BKE22590 ([gene|057BFF91609C918CEE4E6FF9100A1E4959BF6715|ypiA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATCGGACCGGTCCTTTC,  downstream forward: _UP4_TAAGCAGGAATATTAACCAT
BKK22590 ([gene|057BFF91609C918CEE4E6FF9100A1E4959BF6715|ypiA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATCGGACCGGTCCTTTC,  downstream forward: _UP4_TAAGCAGGAATATTAACCAT
References
21710567

057BFF91609C918CEE4E6FF9100A1E4959BF6715

Page visits: 890

Time of last update: 2022-12-02 01:41:28

Author of last update: Jstuelk