sdpB

sdpB
168

membrane protein, required for [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin maturation

locus
BSU_33760
Molecular weight
37.30 kDa
pI
9.52
Protein length
Gene length
function
maturation of the [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin
product
unknown
essential
no
synonyms
sdpB, yvaX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,464,762  3,465,733
The protein
Structure
[AF|O34616]
Paralogous protein(s)
[protein|81E929FD7F66A996300C8412BE172883C262BD67|yitO]
[wiki|Localization]
cell membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]-[gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]-[gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]
description
[Pubmed|12817086]
regulation
expressed under conditions that trigger sporulation ([wiki|Spo0A]) [pubmed|14651647,15687200]
expression
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|14651647,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|15743949], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [PubMed|15687200,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
additional information
the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab

[gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]→[gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]

2022-12-02 00:13:17

Jstuelk

43

2FCAA28FD6DF9E360EB7B7713A66BCCA85A76C64

29EABA10B87FFC2DBA2CD17C1DA823E6512A5B7B

Biological materials
Mutant
MGNA-A449 (yvaX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/449 NBRP B. subtilis, Japan]
BKE33760 ([gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTCATACTATTTTTATTTT,  downstream forward: _UP4_TAACATTTAGATAATGGAGA
BKK33760 ([gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTCATACTATTTTTATTTT,  downstream forward: _UP4_TAACATTTAGATAATGGAGA
References
Reviews
20955377
Original Publications
12817086,14651647,15687200,15743949,15687200,17720793,18763711,23687264,21815947,23033921,35171018

073D63E17C8248BE39F331FDE9902E21A34056D5

Page visits: 1579

Time of last update: 2022-11-27 03:49:06

Author of last update: Jstuelk