SubtiWiki SubtiWiki
csbC

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

csbC
168

general stress protein, similar to sugar-H+ symporter, required for protection against paraquat stress

locus
BSU_39810
Molecular weight
49.97 kDa
pI
9.94
Protein length
Gene length
function
protection against paraquat stress
product
putative sugar-H+ symporter
essential
no
synonyms
csbC, yxcC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
4,088,002  4,089,387
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
[wiki|Domains]
contains 12 trans-membrane domains [Pubmed|23180473]
Structure
[PDB|4LDS] (from Staphylococcus epidermidis, 54% identity) [pubmed|24127585]
Paralogous protein(s)
[protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|CsbC], [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT], [protein|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|araE], [protein|7CE5A42042E5D52768735E795DB805530691D8A6|ywtG], [protein|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG], [protein|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|yncC]
[wiki|Localization]
homogeneously distributed in the cell membrane [Pubmed|23180473]
Expression and Regulation
Operons
genes
[gene|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC]
regulation
induced by stress ([gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC]

2021-11-30 09:58:59

Bzhu

9

da762220a69a05baba2e7565b8c2bfba582c0e68

3B89CDF20FDDFDCB16E07F28824F97D3AE495FAC

Biological materials
Mutant
MGNA-B695 (yxcC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1694 NBRP B. subtilis, Japan]
BKE39810 ([gene|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAAATGTCTCCTCCTCAG,  downstream forward: _UP4_TAAAAAAAGGAATCGTCTCC
BKK39810 ([gene|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAAATGTCTCCTCCTCAG,  downstream forward: _UP4_TAAAAAAAGGAATCGTCTCC
References
10376822,21630458,15805528,23180473,22582280,24127585

0757FAEB38AA1C599C5067794AF83A4BA5912DC9

Page visits: 1626

Time of last update: 2022-01-17 21:46:09

Author of last update: Melvin.boenninger