SubtiWiki SubtiWiki
yfmN

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yfmN
168

unknown

locus
BSU_07410
Molecular weight
5.79 kDa
pI
9.02
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yfmN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
814,109  814,264
Biological materials
Mutant
MGNA-C328 (yfmN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2326 NBRP B. subtilis, Japan]
BKE07410 ([gene|07B6C61C4348AFA27A9FE15D5EEE4E1597345134|yfmN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGCAAACGTCCCCTCTA,  downstream forward: _UP4_TGACACTTGATGAATTCACA
BKK07410 ([gene|07B6C61C4348AFA27A9FE15D5EEE4E1597345134|yfmN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGCAAACGTCCCCTCTA,  downstream forward: _UP4_TGACACTTGATGAATTCACA

07B6C61C4348AFA27A9FE15D5EEE4E1597345134

Page visits: 701

Time of last update: 2021-11-25 09:46:21

Author of last update: Bzhu