yfmN

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yfmN
168

unknown

locus
BSU_07410
Molecular weight
5.79 kDa
pI
9.02
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yfmN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
814,109  814,264
The protein
Structure
[AF|O06472]
Biological materials
Mutant
MGNA-C328 (yfmN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2326 NBRP B. subtilis, Japan]
BKE07410 ([gene|07B6C61C4348AFA27A9FE15D5EEE4E1597345134|yfmN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGCAAACGTCCCCTCTA,  downstream forward: _UP4_TGACACTTGATGAATTCACA
BKK07410 ([gene|07B6C61C4348AFA27A9FE15D5EEE4E1597345134|yfmN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGCAAACGTCCCCTCTA,  downstream forward: _UP4_TGACACTTGATGAATTCACA

07B6C61C4348AFA27A9FE15D5EEE4E1597345134

Page visits: 758

Time of last update: 2022-05-24 13:54:46

Author of last update: Bzhu