yrrB

yrrB
168

unknown

locus
BSU_27490
Molecular weight
22.94 kDa
pI
4.33
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yrrB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0457

This gene is a member of the following regulons

Gene
Coordinates
2,808,707  2,809,327
The protein
[wiki|Domains]
contains six [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)[Pubmed|17624311]
Structure
[PDB|2Q7F] [Pubmed|17624311]
[AF|O34452]
Expression and Regulation
Operons
genes
[gene|50930C56C27D22715620A350220E3C56ADB41020|cymR]-[gene|4F5945C3C8F18BD1B30D97CD516A06077C200B9D|yrvO]-[gene|2F5DFBE980FFF5810B76BCFCD189BA0F6C415B4F|trmU]-[gene|07DFF7D7BE1BACFB148F600400BDE5933BF1DD07|yrrB]-[gene|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2]
description
[Pubmed|22383849]
Open in new tab

[gene|50930C56C27D22715620A350220E3C56ADB41020|cymR]→[gene|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2]

2022-11-30 01:20:08

Jstuelk

36

abda92d242629b6aea524d43804e9037e28674a8

021F54A200AB704BB82EBD13945C64A7665E25EA

Biological materials
Mutant
MGNA-A859 (yrrB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/859 NBRP B. subtilis, Japan]
BKE27490 ([gene|07DFF7D7BE1BACFB148F600400BDE5933BF1DD07|yrrB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE27490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGCCTCTATACCGAGTT,  downstream forward: _UP4_TAACAGGCACAGGAGGAGGG
BKK27490 ([gene|07DFF7D7BE1BACFB148F600400BDE5933BF1DD07|yrrB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK27490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGCCTCTATACCGAGTT,  downstream forward: _UP4_TAACAGGCACAGGAGGAGGG
References
17624311

07DFF7D7BE1BACFB148F600400BDE5933BF1DD07

Page visits: 1035

Time of last update: 2022-11-26 12:21:51

Author of last update: Jstuelk