appA/2

appA/2
168

oligopeptide ABC transporter, inactive pseudogene in strain 168

locus
BSU_11382
Protein length
Gene length
function
unknown
product
oligopeptide ABC transporter
essential
no
synonyms
appA\/2
Outlinks

Genomic Context

Categories containing this gene/protein

This gene is a member of the following regulons

Gene
Coordinates
1,214,001  1,215,167
The protein
Protein family
[wiki|bacterial solute-binding protein 5 family] (according to UniProt)
Structure
[PDB|1XOC] (the intact protein) [pubmed|15588833]
Expression and Regulation
Operons
genes
[gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]-[gene|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|appF]-[gene|DD2C5F549759447FF1C30E5B43BCB74CE4320EF3|appA/1]-[gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]-[gene|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]-[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]
description
[Pubmed|7997159]
regulation
repressed by [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY] [Pubmed|12618455]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|25755103], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|10383984], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
Open in new tab

[gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]→[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]

2023-02-02 01:16:31

Jstuelk

42

b46f08a2cd8f8540d1ae7be3ab793fb86c3b4d9c

D515582AF1C173F5A0D9E2C830FC884903502563

Biological materials
Mutant
GP2100 (D(''[gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]-[gene|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|appF]-[gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]-[gene|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]-[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]'')::''spc''), available in [wiki|Jörg Stülke]'s lab
BKE11382 ([gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11382 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCCTTTTTTTCTACGGATTT,  downstream forward: _UP4_TAAATTTCCCTTAAAGGGGA
BKK11382 ([gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11382 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCCTTTTTTTCTACGGATTT,  downstream forward: _UP4_TAAATTTCCCTTAAAGGGGA

082D2012ABE3671F62211F77ED501849BF77B4EF

Page visits: 977

Time of last update: 2023-02-07 16:15:45

Author of last update: Jstuelk