SubtiWiki SubtiWiki
yosP

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yosP
168

similar to ribonucleoside-diphosphate reductase (beta subunit)

locus
BSU_20040
Molecular weight
22.51 kDa
pI
6.09
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yosP, nrdF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0208

This gene is a member of the following regulons

Gene
Coordinates
2,159,981  2,161,778
The protein
Catalyzed reaction/ biological activity
[thioredoxin]-disulfide + 2'-deoxyribonucleoside 5'-diphosphate + H2O --> [thioredoxin]-dithiol + ribonucleoside 5'-diphosphate (according to UniProt)
Protein family
ribonucleoside diphosphate reductase small chain family (with [protein|CD2D14FE9C10544E7C350167EBDBD941B898051D|nrdF], according to UniProt)
Structure
[PDB|4DR0] ( from Bacillus Subtilis 87% identity)
Paralogous protein(s)
[protein|CD2D14FE9C10544E7C350167EBDBD941B898051D|nrdF]
Biological materials
Mutant
BKE20040 ([gene|08B733574DC7B8D044033EBB94124D470A0FBE19|yosP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCCTACATATACGCCAT,  downstream forward: _UP4_TTTACCGAGAAAGGATGTAT
BKK20040 ([gene|08B733574DC7B8D044033EBB94124D470A0FBE19|yosP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCCTACATATACGCCAT,  downstream forward: _UP4_TTTACCGAGAAAGGATGTAT
References
21498918,11470879,16621400,9465078

08B733574DC7B8D044033EBB94124D470A0FBE19

Page visits: 1703

Time of last update: 2022-01-24 21:50:48

Author of last update: Melvin.boenninger