yrkN

yrkN
168

unknown

locus
BSU_26450
Molecular weight
21.12 kDa
pI
5.2
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yrkN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,707,127  2,707,684
The protein
[wiki|Domains]
[wiki|N-acetyltransferase domain] (aa 9-169) (according to UniProt)
Structure
[AF|P54441]
Expression and Regulation
Operons
genes
[gene|6F219CFF60072A01EDF98DC1EE41078EE49CB8D6|yrkO]-[gene|096065A2720AD9F185D6E4A40DE196B1F9AF6DE9|yrkN]
description
[pubmed|22383849]
regulatory mechanism
[protein|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP]: activation, [Pubmed|18175906], in [regulon|protein:1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP regulon]
Open in new tab

[gene|6F219CFF60072A01EDF98DC1EE41078EE49CB8D6|yrkO]->[gene|096065A2720AD9F185D6E4A40DE196B1F9AF6DE9|yrkN]

2022-11-17 09:08:36

Bzhu

10

c82027937508c66b73be941a10f921ac0f50d15c

08FE0402860BBFF0BF4F44FA6029676C7F3F125A

Biological materials
Mutant
MGNA-C504 (yrkN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2502 NBRP B. subtilis, Japan]
BKE26450 ([gene|096065A2720AD9F185D6E4A40DE196B1F9AF6DE9|yrkN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTTCACTCCCTCA,  downstream forward: _UP4_TAAACAATTGAACACGGCGA
BKK26450 ([gene|096065A2720AD9F185D6E4A40DE196B1F9AF6DE9|yrkN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTTCACTCCCTCA,  downstream forward: _UP4_TAAACAATTGAACACGGCGA
References
18175906

096065A2720AD9F185D6E4A40DE196B1F9AF6DE9

Page visits: 929

Time of last update: 2022-11-27 06:33:59

Author of last update: Melvin.boenninger