sipW

sipW
168

bifunctional signal peptidase I that controls surface-adhered [wiki|biofilm formation] and processes [protein|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA] and [protein|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]

locus
BSU_24630
Molecular weight
20.53 kDa
pI
5.49
Protein length
Gene length
function
[wiki|biofilm formation]
product
signal peptidase I
essential
no
synonyms
sipW, yqhE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0681

This gene is a member of the following regulons

Gene
Coordinates
2,553,930  2,554,502
The protein
Catalyzed reaction/ biological activity
important for [wiki|biofilm formation] on a solid surface, but not required at an air-liquid interface [Pubmed|22328672]
Cleavage of hydrophobic, N-terminal signal or leader sequences from [protein|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA] and [protein|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA] [Pubmed|10049401,10559173]
Protein family
peptidase S26B family (single member, according to UniProt)
Structure
[AF|P54506]
[wiki|Localization]
membrane [Pubmed|22328672]
Expression and Regulation
Operons
genes
[gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]-[gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]
description
[Pubmed|16430695]
regulation
repressed by casamino acids [Pubmed|12107147]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [PubMed|10464223,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|16430695], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]: activation, [Pubmed|24196425], in [regulon|protein:E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16430695], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] [PubMed|15661000,19788541] or by SlrR [PubMed|20351052]
expression of the operon is localized to a ring near the periphery of the biofilm [pubmed|29590605]
Open in new tab

[gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]→[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]

2022-11-22 14:18:09

Jstuelk

64

5d4b2839ae781570552ba6a28b48e7489d628dd2

25F0FAE210D5101B1935E4625742633C173FC509

Biological materials
Mutant
MGNA-C439 (yqhE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2437 NBRP B. subtilis, Japan]
1A937 ( ''sipW''::''kan''), [Pubmed|15101989], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A937&Search=1A937 BGSC]
BKE24630 ([gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGTAAAGATGATCACGTATA,  downstream forward: _UP4_TAACTTCAGTTGTAAACCTG
BKK24630 ([gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGTAAAGATGATCACGTATA,  downstream forward: _UP4_TAACTTCAGTTGTAAACCTG
labs
[wiki|Beth Lazazzera], Los Angeles, USA
References
Reviews
21488983,22427624,22688815,33824496,34410368
Original Publications
22328672,18047568,15175311,16430695,10368135,9694797,18430133,18647168,10464223,17720793,20351052,10827084,21477127,10559173,23646920,21856853,21815947,29590605

09B082BF39703F0D9A5980E643175DBD59F5B228

Page visits: 2975

Time of last update: 2022-11-26 20:38:48

Author of last update: Jstuelk