yfiS

yfiS
168

similar to multidrug resistance protein

locus
BSU_08380
Molecular weight
44.24 kDa
pI
9.6
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfiS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
912,547  913,800
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|TCR/Tet family] (according to UniProt)
Structure
[AF|O31561]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]-[gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]
description
(according to [http://dbtbs.hgc.jp/COG/prom/yfiSR.html DBTBS]) null
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|25755103], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|15DE8BAFB36296B5842E283C836D600755786397|yfiR]: repression, [pubmed|], in [regulon|protein:15DE8BAFB36296B5842E283C836D600755786397|yfiR regulon]
Open in new tab

[gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]→[gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]

2022-11-28 20:35:10

ghost

12

e2db64fbbffe2c820143dd4511a162c28df1e168

8E2244D7A5B8A3B84C851A9EE6C6949347A52F91

Biological materials
Mutant
MGNA-C306 (yfiS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2304 NBRP B. subtilis, Japan]
BKE08380 ([gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATCCTCCTGATT,  downstream forward: _UP4_AAAATTGCAGAAAGCAGGCG
BKK08380 ([gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATCCTCCTGATT,  downstream forward: _UP4_AAAATTGCAGAAAGCAGGCG
References
16862575

09D56215645F3E13803704F96FC6AD3FAAD58EF4

Page visits: 1293

Time of last update: 2022-12-01 18:55:20

Author of last update: Melvin.boenninger