yfiS

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yfiS
168

similar to multidrug resistance protein

locus
BSU_08380
Molecular weight
44.24 kDa
pI
9.6
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfiS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
912,547  913,800
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|TCR/Tet family] (according to UniProt)
Structure
[AF|O31561]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]-[gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]
description
(according to [http://dbtbs.hgc.jp/COG/prom/yfiSR.html DBTBS]) null
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|25755103], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|15DE8BAFB36296B5842E283C836D600755786397|yfiR]: repression, [pubmed|], in [regulon|protein:15DE8BAFB36296B5842E283C836D600755786397|yfiR regulon]
Open in new tab

[gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]→[gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]

2022-01-21 05:54:05

ghost

6

e2db64fbbffe2c820143dd4511a162c28df1e168

8E2244D7A5B8A3B84C851A9EE6C6949347A52F91

Biological materials
Mutant
MGNA-C306 (yfiS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2304 NBRP B. subtilis, Japan]
BKE08380 ([gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATCCTCCTGATT,  downstream forward: _UP4_AAAATTGCAGAAAGCAGGCG
BKK08380 ([gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATCCTCCTGATT,  downstream forward: _UP4_AAAATTGCAGAAAGCAGGCG
References
16862575

09D56215645F3E13803704F96FC6AD3FAAD58EF4

Page visits: 1188

Time of last update: 2022-05-19 19:11:31

Author of last update: Melvin.boenninger