SubtiWiki SubtiWiki
yfkH

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yfkH
168

general stress protein, survival of ethanol and paraquat stresses

locus
BSU_07900
Molecular weight
30.32 kDa
pI
8.42
Protein length
Gene length
function
survival of stress conditions
product
unknown
essential
no
synonyms
yfkH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1295

This gene is a member of the following regulons

Gene
Coordinates
862,836  863,663
The protein
[wiki|Localization]
membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|yfkJ]-[gene|A38D85EE1BCCA5E5E77CAF9583E7D052BB7F8188|yfkI]-[gene|0A9352AB10C7DC06BF477EBE384D6E21D920AAC8|yfkH]
description
[Pubmed|22383849]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528,11532142]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11532142], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528,11532142], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|yfkJ]→[gene|0A9352AB10C7DC06BF477EBE384D6E21D920AAC8|yfkH]

2022-01-22 07:10:36

Jstuelk

6

414988eb39ed35bf7e943cad2a5639654c38211e

02A1CA317676092BC72B700F05F049C865AA2EF5

Biological materials
Mutant
MGNA-C268 (yfkH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2266 NBRP B. subtilis, Japan]
BKE07900 ([gene|0A9352AB10C7DC06BF477EBE384D6E21D920AAC8|yfkH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTCTCACCTCGCAT,  downstream forward: _UP4_TAGCGCACCCTATAAACGAA
BKK07900 ([gene|0A9352AB10C7DC06BF477EBE384D6E21D920AAC8|yfkH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTCTCACCTCGCAT,  downstream forward: _UP4_TAGCGCACCCTATAAACGAA
References
15805528,11532142,22582280

0A9352AB10C7DC06BF477EBE384D6E21D920AAC8

Page visits: 1187

Time of last update: 2022-01-21 19:29:15

Author of last update: Jstuelk