ybfI

ybfI
168

similar to transcription factor ([wiki|AraC family])

locus
BSU_02220
Molecular weight
32.29 kDa
pI
6.1
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ybfI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2207

This gene is a member of the following regulons

Gene
Coordinates
242,834  243,661
The protein
Protein family
[wiki|AraC family]
[wiki|Domains]
[wiki|HTH araC/xylS-type domain] (aa 171-268) (according to UniProt)
Structure
[AF|O31449]
Expression and Regulation
Operons
genes
[gene|0AD208CFDA10F7BED022583C8448EFA7E37B9E33|ybfI]-[gene|5084B6223B9F261E9FE1C65CD3F5FE20AF7E5ECE|ybfH]
description
[Pubmed|22383849]
Open in new tab

[gene|0AD208CFDA10F7BED022583C8448EFA7E37B9E33|ybfI]→[gene|5084B6223B9F261E9FE1C65CD3F5FE20AF7E5ECE|ybfH]

2022-09-08 10:25:05

Jstuelk

11

96930bc6f3d45b8344be09939d97830108847977

F7F7581C5C602A2B1305A943D91F26A17C07592B

Biological materials
Mutant
MGNA-B970 (ybfI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1969 NBRP B. subtilis, Japan]
BKE02220 ([gene|0AD208CFDA10F7BED022583C8448EFA7E37B9E33|ybfI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGGATGCCTCCTGTCGG,  downstream forward: _UP4_ATTTTTGAAAAGGAGCTTCA
BKK02220 ([gene|0AD208CFDA10F7BED022583C8448EFA7E37B9E33|ybfI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGGATGCCTCCTGTCGG,  downstream forward: _UP4_ATTTTTGAAAAGGAGCTTCA
References
23504016

0AD208CFDA10F7BED022583C8448EFA7E37B9E33

Page visits: 891

Time of last update: 2022-09-26 23:23:49

Author of last update: Melvin.boenninger