rhiG

rhiG
168

[wiki|ABC transporter] (membrane protein) for rhamnose oligosaccharides

locus
BSU_06990
Molecular weight
33.32 kDa
pI
9.52
Protein length
Gene length
function
uptake of rhamnose oligosaccharides
product
rhamnose oligosaccharide [wiki|ABC transporter]
essential
no
synonyms
rhiG, yesQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0395

This gene is a member of the following regulons

Gene
Coordinates
763,875  764,765
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|MalFG subfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transmembrane type-1 domain] (aa 91-282) (according to UniProt)
Structure
[PDB|4TQU] (from Sphingomonas sp., 25% identity) [pubmed|26235029]
[AF|O31520]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]-[gene|2DC415DCC2ECC3B46526108638DDB46C28832041|rhiF]-[gene|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|rhiG]-[gene|8EED04FCE6E2900B729178209FB281F5463B2540|rhiN]-[gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]-[gene|585CA3154C0405697C4707E5B1D9359963999C54|yesT]-[gene|E4C4AEBA8DAEF7DA1B49432213B2B3EA2AF6B34B|yesU]-[gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]-[gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]-[gene|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]-[gene|578B79EB64B804FCAACA73AB22458481371A815C|yesY]-[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]
description
[Pubmed|22383849]
regulation
induced by pectin ([protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR], [protein|F09661C8A483D0FC796204102021104A4373F895|rhgL]) [Pubmed|19651770,35881471]
repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [pubmed|35881471]
regulatory mechanism
[protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]: activation, [Pubmed|19651770], in [regulon|protein:BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: Sigma factor, [pubmed|35881471], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|F09661C8A483D0FC796204102021104A4373F895|rhgL]: activation, [pubmed|35881471], in [regulon|protein:F09661C8A483D0FC796204102021104A4373F895|rhgL regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [pubmed|35881471], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
Open in new tab

[gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]→[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]

2022-12-04 00:23:36

Jstuelk

43

D891C8F38E150B653BA655BA6352352D86D18BAE

A10D4124F5AF6831808648D33C98AF061D3703AA

Biological materials
Mutant
MGNA-A949 (yesQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/949 NBRP B. subtilis, Japan]
BKE06990 ([gene|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|rhiG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGGCTGGTTGACCGGCTCCA,  downstream forward: _UP4_TTAAAATAAAAAGGAGTGTT
BKK06990 ([gene|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|rhiG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGGCTGGTTGACCGGCTCCA,  downstream forward: _UP4_TTAAAATAAAAAGGAGTGTT
References
10092453,17449691,24391637,26235029

0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4

Page visits: 1558

Time of last update: 2022-12-04 03:41:26

Author of last update: Melvin.boenninger