murQ

murQ
168

N-acetyl-muramic acid-6P etherase (cleaves lactate from N-acetylmuramic acid)

locus
BSU_01700
Molecular weight
32.55 kDa
pI
5.4
Protein length
Gene length
function
cell wall turnover
product
N-acetyl-muramic acid-6P etherase
essential
no
synonyms
murQ, ybbI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2103

This gene is a member of the following regulons

Gene
Coordinates
192,051  192,965
Phenotypes of a mutant
strongly reduced viability during prolonged incubation in stationary phase [Pubmed|27729505]
The protein
Catalyzed reaction/ biological activity
H2O + N-acetyl-D-muramate 6-phosphate --> (R)-lactate + N-acetyl-D-glucosamine 6-phosphate (according to UniProt)
Protein family
GCKR-like family (single member, according to UniProt)
[wiki|Domains]
[wiki|SIS domain] (aa 59-222) (according to UniProt)
Structure
[PDB|4S12] (from Yersinia enterocolitica, 51% identity)
[AF|Q45582]
Modification
phosphorylation on Ser-2 [Pubmed|17218307]
Expression and Regulation
Operons
genes
[gene|0B1F43F43A4DC1574A153DBFBAA5D0A1855F9B61|murQ]-[gene|125872506C400CB6B3DAEA8B5130B064DFBA4494|murR]-[gene|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|murP]-[gene|DEACFD435DB01C4B3ADEF397BEE08E2E7C7FCC36|amiE]-[gene|A5D4BF262BD365DCEBA9358C8DB295E605DE4D84|nagZ]-[gene|005D37F34CA3D6891F7D8FF7A2AFA1CBCB556FFE|namZ]
description
[Pubmed|22383849]
regulation
expressed in late exponential and early stationary phase [Pubmed|20400549]
regulatory mechanism
[protein|125872506C400CB6B3DAEA8B5130B064DFBA4494|murR]: repression, [pubmed|30038046], in [regulon|protein:125872506C400CB6B3DAEA8B5130B064DFBA4494|murR regulon]
Open in new tab

[gene|0B1F43F43A4DC1574A153DBFBAA5D0A1855F9B61|murQ]→[gene|005D37F34CA3D6891F7D8FF7A2AFA1CBCB556FFE|namZ]

2022-11-28 12:56:24

Jstuelk

44

63a61d46d8ccef554859655721937254bb90adc4

0CB715DED62C09573A88E4102ECFE473836124B4

Biological materials
Mutant
MGNA-B952 (ybbI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1951 NBRP B. subtilis, Japan]
BKE01700 ([gene|0B1F43F43A4DC1574A153DBFBAA5D0A1855F9B61|murQ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGGATGCCCCCTGTTT,  downstream forward: _UP4_CATCCATGATAAGGAGAGAA
BKK01700 ([gene|0B1F43F43A4DC1574A153DBFBAA5D0A1855F9B61|murQ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGGATGCCCCCTGTTT,  downstream forward: _UP4_CATCCATGATAAGGAGAGAA
References
17218307,20400549,22383849,27729505,30038046

0B1F43F43A4DC1574A153DBFBAA5D0A1855F9B61

Page visits: 2325

Time of last update: 2022-12-02 15:51:52

Author of last update: Melvin.boenninger