stoA

stoA
168

thiol-disulfide oxidoreductase, with thioredoxin-like domain, required for the synthesis of the endospore peptidoglycan cortex

locus
BSU_13840
Molecular weight
18.66 kDa
pI
5.3
Protein length
Gene length
function
spore cortex formation, maturation of [protein|38FD9805815BBDDD83789F0F402C0FB221B65FF4|spoVD] in the forespore outer membrane
product
thiol-disulfide oxidoreductase
essential
no
synonyms
stoA, spoIVH, ykvV

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1225

This gene is a member of the following regulons

Gene
Coordinates
1,450,638  1,451,135
The protein
Catalyzed reaction/ biological activity
reduction of intramolecular disulfide bonds in [protein|38FD9805815BBDDD83789F0F402C0FB221B65FF4|spoVD] in the forespore outer membrane [Pubmed|19919673]
Protein family
[wiki|Thioredoxin family] (according to UniProt)
[wiki|Domains]
[wiki|Thioredoxin domain] (aa 27-165) (according to UniProt)
Structure
[PDB|3ERW] [pubmed|19144642]
[AF|O31687]
Paralogous protein(s)
[protein|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|yneN], [protein|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]
[wiki|Localization]
forespore envelope [Pubmed|19919673]
Expression and Regulation
Operons
genes
[gene|34A5CD28A3DBCB10B4E1C82E50143FA73B553919|ykvU]-[gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA]
description
[Pubmed|15292147]
regulation
expressed during sporulation ([protein|search|SigE], [protein|search|SigG]) [Pubmed|12662922,15292147]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|12662922], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15292147], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
additional information
A [protein|search|ncRNA] is predicted between '[protein|search|stoA]' and '[protein|search|zosA]' [PubMed|20525796]
Open in new tab

[gene|34A5CD28A3DBCB10B4E1C82E50143FA73B553919|ykvU]→[gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA]

2023-02-05 13:50:22

ghost

35

3f29e851b9272b82f35016e1c94326de0561a90a

9220572966C02298CE954C13B4A353E578A52885

genes
[gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA]
description
[Pubmed|15292147]
regulation
expressed during sporulation ([protein|search|SigE], [protein|search|SigG]) [Pubmed|12662922,15292147]
additional information
A [protein|search|ncRNA] is predicted between '[protein|search|stoA]' and '[protein|search|zosA]' [PubMed|20525796]
Open in new tab

[gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA]

2023-01-23 12:13:22

ghost

17

3ea69dbde0188d526911a18346dab4b4d7840518

D2FE502A883E3ECE905BC4454B77FAF9422DEABF

Biological materials
Mutant
MGNA-B328 (ykvV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1327 NBRP B. subtilis, Japan]
1S130 ( ''stoA''::''cat''), [Pubmed|15342593], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S130&Search=1S130 BGSC]
1S131 ( ''stoA''::''tet''), [Pubmed|15342593], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S131&Search=1S131 BGSC]
BKE13840 ([gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCTTCCTTTCATG,  downstream forward: _UP4_TAGCTGAGAGCATAGACTCT
BKK13840 ([gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCTTCCTTTCATG,  downstream forward: _UP4_TAGCTGAGAGCATAGACTCT
labs
[wiki|Lars Hederstedt], University of Lund, Sweden  [http://www.cob.lu.se/microbiology/heme.html Homepage]
References
Reviews
19919674,35638784
Original Publications
12662922,15292147,15342593,19144642,19919673,20525796,28383125

0B299F9459023306FA91298A6162A09E4A87C3B2

Page visits: 1639

Time of last update: 2023-02-05 13:49:07

Author of last update: Christoph.elfmann