rsbU

rsbU
168

protein serine phosphatase, environmental PP2C, dephosphorylates [protein|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]

locus
BSU_04700
Molecular weight
38.48 kDa
pI
4.91
Protein length
Gene length
function
control of [protein|search|SigB ]activity
product
protein serine phosphatase, environmental PP2C
essential
no
ec
3.1.3.3
synonyms
rsbU

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2208

This gene is a member of the following regulons

Gene
Coordinates
521,019  522,026
The protein
Catalyzed reaction/ biological activity
O-phospho-L(or D)-serine + H2O --> L(or D)-serine + phosphate (according to UniProt)
[wiki|Domains]
[wiki|PPM-type phosphatase domain] (aa 123-333) (according to UniProt)
Structure
[PDB|2J6Y]
[AF|P40399]
Expression and Regulation
Operons
genes
[gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]-[gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]-[gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]-[gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]-[gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
description
[Pubmed|8002610]
regulation
''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|20454630], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8002610], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]→[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]

2022-11-23 08:48:25

ghost

52

5f220975cc2493224a8aa0770ee2187c815a2127

3EFC8DC1AC54632D4F2AC30497749AB5CCA3A39F

Biological materials
Mutant
BKE04700 ([gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCTAAAATCCACGTTCTTAC,  downstream forward: _UP4_TAACGTCTGTCAGACGAGGG
BKK04700 ([gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCTAAAATCCACGTTCTTAC,  downstream forward: _UP4_TAACGTCTGTCAGACGAGGG
labs
[wiki|Bill Haldenwang], San Antonio, USA
[wiki|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
[wiki|Rick Lewis], Newcastle, UK [http://www.ncl.ac.uk/camb/staff/profile/r.lewis homepage]
References
Reviews
20658979,33042030
Original Publications
27977677,10632888,8002610,28461450,33684446

0B8381D2C724DAA724E4AFC67000F12AD112D13D

Page visits: 2600

Time of last update: 2022-11-29 03:14:14

Author of last update: Jstuelk