nagB

nagB
168

glucosamine-6-phosphate deaminase

locus
BSU_35020
Molecular weight
26.84 kDa
pI
5.72
Protein length
Gene length
function
N-acetylglucosamine utilization
product
glucosamine-6-phosphate deaminase
essential
no
synonyms
nagB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0363

This gene is a member of the following regulons

Gene
Coordinates
3,596,543  3,597,271
The protein
Catalyzed reaction/ biological activity
α-D-glucosamine 6-phosphate + H2O --> β-D-fructose 6-phosphate + NH4+ (according to UniProt)
Protein family
glucosamine/galactosamine-6-phosphate isomerase family (with [protein|8BBC9AFF4CD56A3A66E270A2BBA193D095EE01D1|gamA], according to UniProt)
Structure
[PDB|2BKX] [Pubmed|15755726]
[AF|O35000]
Paralogous protein(s)
[protein|8BBC9AFF4CD56A3A66E270A2BBA193D095EE01D1|gamA]
Expression and Regulation
Operons
genes
[gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]-[gene|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|nagB]-[gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]
description
[Pubmed|21602348]
regulation
induced in the presence of N-acetylglucosamine ([protein|search|NagR]) [Pubmed|24673833,21602348,14343123]
regulatory mechanism
[protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]: repression, [Pubmed|24673833,21602348], in [regulon|protein:6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|23667565], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]→[gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]

2022-11-26 05:24:36

ghost

25

dfb9f60c6cb4712882f6e111396691335972d607

2CE10C0E65E696F5F9B1AAC17ED9D19E163A6ECF

Biological materials
Mutant
MGNA-A336 (nagB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/336 NBRP B. subtilis, Japan]
BKE35020 ([gene|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|nagB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATACGTTTGACATTCCATTA,  downstream forward: _UP4_CCTTGAAAGGAACATGCTGA
BKK35020 ([gene|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|nagB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATACGTTTGACATTCCATTA,  downstream forward: _UP4_CCTTGAAAGGAACATGCTGA
References
Reviews
26159076
Original Publications
6174502,15755726,21821766,21602348,23667565,24673833,23876412,25564531

0C8D7EAC2656E989E45B5B7E42FAA6D258956B56

Page visits: 1640

Time of last update: 2022-11-29 02:18:55

Author of last update: Melvin.boenninger