SubtiWiki SubtiWiki
yugN

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yugN
168

unknown

locus
BSU_31330
Molecular weight
14.98 kDa
pI
4.1
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yugN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,219,837  3,220,241
The protein
Structure
[PDB|2PWW] (from B. clausii, 31% identity)
Expression and Regulation
Operons
genes
[gene|E3DAC5DE86EE0E34C6ECB6DE1E41309742465CF9|pgi]-[gene|BD63E58F9CF99F9A1888099F3393B30DE3F164F5|yugM]-[gene|0C8E5DFD40F4B2EB540199DFB2520E3FBC878530|yugN]
description
[Pubmed|11489127]
regulation
constitutively expressed [Pubmed|11489127]
Open in new tab

[gene|E3DAC5DE86EE0E34C6ECB6DE1E41309742465CF9|pgi]→[gene|0C8E5DFD40F4B2EB540199DFB2520E3FBC878530|yugN]

2022-01-16 03:26:29

ghost

9

aea70d5253c79b98d56a32d7b8d16048ad6e6fb7

8E597C166D57BC7003E745D5E0D4772E89D7C363

Biological materials
Mutant
MGNA-A618 (yugN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/618 NBRP B. subtilis, Japan]
BKE31330 ([gene|0C8E5DFD40F4B2EB540199DFB2520E3FBC878530|yugN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAGAATGCCCCTTTTTT,  downstream forward: _UP4_GAATTGGAGGATGTTCTGTT
BKK31330 ([gene|0C8E5DFD40F4B2EB540199DFB2520E3FBC878530|yugN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAGAATGCCCCTTTTTT,  downstream forward: _UP4_GAATTGGAGGATGTTCTGTT
References
11489127

0C8E5DFD40F4B2EB540199DFB2520E3FBC878530

Page visits: 1006

Time of last update: 2022-01-26 18:01:09

Author of last update: Jstuelk