yitZ

yitZ
168

similar to multidrug resistance protein

locus
BSU_11180
Molecular weight
18.21 kDa
pI
9.57
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yitZ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,194,333  1,194,827
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[AF|P70952]
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
MGNA-B206 (yitZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1205 NBRP B. subtilis, Japan]
BKE11180 ([gene|0CEC7E285E6FC7796EEA3535F48C3420E1399E6B|yitZ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGCTGCTTTGTGATAATG,  downstream forward: _UP4_TGACGCGGTCAGCCTGTTTT
BKK11180 ([gene|0CEC7E285E6FC7796EEA3535F48C3420E1399E6B|yitZ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGCTGCTTTGTGATAATG,  downstream forward: _UP4_TGACGCGGTCAGCCTGTTTT

0CEC7E285E6FC7796EEA3535F48C3420E1399E6B

Page visits: 758

Time of last update: 2022-11-27 08:09:25

Author of last update: Melvin.boenninger