epsN

epsN
168

UDP-2,6-dideoxy 2-acetamido 4-keto glucose aminotransferase, required for extracellular polysaccharide synthesis

locus
BSU_34230
Molecular weight
42.76 kDa
pI
5.84
Protein length
Gene length
function
[category|SW.4.1.2|Biofilm formation], biosynthesis of N,N'-diacetylbacillosamine
product
UDP-2,6-dideoxy 2-acetamido 4-keto glucose aminotransferase
essential
no
synonyms
epsN, yvfE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0399

This gene is a member of the following regulons

Gene
Coordinates
3,515,062  3,516,228
Phenotypes of a mutant
smooth colonies on MsGG medium, no [wiki|biofilm formation] [Pubmed|22113911]
The protein
Catalyzed reaction/ biological activity
conversion of UDP-2,6-dideoxy 2-acetamido 4-keto glucose to UDP-2,6-dideoxy 2-acetamido 4-amino glucose [pubmed|29982582]
Protein family
DegT/DnrJ/EryC1 family (with [protein|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA] and [protein|38DBA751456A0C0EC5D028939ADB8860ADA28F94|spsC], according to UniProt)
[wiki|Cofactors]
pyridoxal phosphate [pubmed|29982582]
Structure
[PDB|1O61] (from Campylobacter jejuni, 46% identity) [wiki|16021622]
[AF|Q795J3]
Expression and Regulation
Operons
genes
[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]
description
[Pubmed|15661000]
regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab

[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]→[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]

2022-11-22 16:41:05

ghost

51

972f8e32dbf02ccc05ec1b86b52f3e7c715bf4da

DAC70A15EA1F43CB18727990D26DF72F59759165

Biological materials
Mutant
MGNA-A064 (yvfE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/64 NBRP B. subtilis, Japan]
BKE34230 ([gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TAAGTAGATTTTTTTATGCA,  downstream forward: _UP4_TTCCATACTGTCGAGGTGAA
BKK34230 ([gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TAAGTAGATTTTTTTATGCA,  downstream forward: _UP4_TTCCATACTGTCGAGGTGAA
labs
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
References
Reviews
20735481
Research papers
29982582,30222950,16021622
The EAR [wiki|RNA switch]
20374491,20230605

0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8

Page visits: 1998

Time of last update: 2022-11-26 23:10:50

Author of last update: Jstuelk