dgk

dgk
168

deoxyguanosine kinase

locus
BSU_00150
Molecular weight
24.00 kDa
pI
5.78
Protein length
Gene length
function
purine salvage and interconversion
product
deoxyguanosine kinase
essential
no
ec
2.7.1.113
synonyms
dgk, yaaG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1428

This gene is a member of the following regulons

Gene
Coordinates
23,146  23,769
The protein
Catalyzed reaction/ biological activity
ATP + deoxyguanosine = ADP + dGMP (according to UniProt)
Protein family
DCK/DGK family (together woth [protein|D749382783437F40AE1C66755F57D44E3FCA193F|dck]) (accoding to UniProt)
Structure
[PDB|2JAQ] (DAK from Mycoplasma mycoides, 35% identity) [pubmed|17229440]
[AF|P37530]
Paralogous protein(s)
[protein|D749382783437F40AE1C66755F57D44E3FCA193F|dck]
[wiki|Localization]
cytoplasm (accoding to UniProt)
Expression and Regulation
Operons
genes
[gene|0DA340B3D23B63C6BD284BF86409558A31B12B53|dgk]-[gene|D749382783437F40AE1C66755F57D44E3FCA193F|dck]
description
[pubmed|22383849]
Open in new tab

[gene|0DA340B3D23B63C6BD284BF86409558A31B12B53|dgk]→[gene|D749382783437F40AE1C66755F57D44E3FCA193F|dck]

2022-11-21 19:39:00

Jstuelk

25

a79e3573c7ef40ce7edc240f2c862e5e075bc687

5B80CB1DA13607F688D45E84AA89AAB4A93774D1

Biological materials
Mutant
MGNA-B888 (yaaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1887 NBRP B. subtilis, Japan]
BKE00150 ([gene|0DA340B3D23B63C6BD284BF86409558A31B12B53|dgk]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00150 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGGAATCCTCCTTATAT,  downstream forward: _UP4_GCCCATGTAAAGGAGCTTAT
BKK00150 ([gene|0DA340B3D23B63C6BD284BF86409558A31B12B53|dgk]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00150 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGGAATCCTCCTTATAT,  downstream forward: _UP4_GCCCATGTAAAGGAGCTTAT
References
11078735,17229440

0DA340B3D23B63C6BD284BF86409558A31B12B53

Page visits: 1025

Time of last update: 2022-12-05 18:03:33

Author of last update: Melvin.boenninger