yxxD

yxxD
168

antitoxin

locus
BSU_39290
Molecular weight
17.52 kDa
pI
3.93
Protein length
Gene length
function
inhibition of the cytotoxic activity of [protein|BD8C0563C7123B6DEC1EEB602BDF2C9D92D34991|yxiD]
product
antitoxin
essential
yes
synonyms
yxxD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
4,036,344  4,036,787
Phenotypes of a mutant
essential [Pubmed|28189581]
The protein
Structure
[AF|P40737]
Expression and Regulation
Operons
genes
[gene|75B0239578C92D4F3B298CBB077635BF5567C590|yxiB]-[gene|F44437883F39E5240D36340A7DD07803C5090ABB|yxiC]-[gene|BD8C0563C7123B6DEC1EEB602BDF2C9D92D34991|yxiD]-[gene|0DAFBDDC5E41592D06F97D404E75AF14B6783729|yxxD]-[gene|2710D9FD5FA50E09B4E482C13140F69B13C71861|yxxE]
description
[Pubmed|22383849,7883710,10746760]
Open in new tab

[gene|75B0239578C92D4F3B298CBB077635BF5567C590|yxiB]→[gene|2710D9FD5FA50E09B4E482C13140F69B13C71861|yxxE]

2022-12-01 06:11:01

Jstuelk

35

6811039ab2839b666e83f7f56b9c32b670963970

12030EE6982066B43F7653DACDC2A8EF2C3924DB

Biological materials
Mutant
MGNA-B786 (yxxD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1785 NBRP B. subtilis, Japan]
BKE39290 ([gene|0DAFBDDC5E41592D06F97D404E75AF14B6783729|yxxD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ACTCATTTTTTTTTGCCTCC,  downstream forward: _UP4_TGATTTTAACATTATCCCGT
BKK39290 ([gene|0DAFBDDC5E41592D06F97D404E75AF14B6783729|yxxD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ACTCATTTTTTTTTGCCTCC,  downstream forward: _UP4_TGATTTTAACATTATCCCGT
References
7883710,10746760,22200572,28189581,34280190

0DAFBDDC5E41592D06F97D404E75AF14B6783729

Page visits: 2695

Time of last update: 2022-12-01 17:53:01

Author of last update: Jstuelk