lip

lip
168

extracellular lipase

locus
BSU_02700
Molecular weight
22.64 kDa
pI
10.06
Protein length
Gene length
function
lipid degradation
product
extracellular lipase
essential
no
synonyms
lip, lipA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1075

This gene is a member of the following regulons

Gene
Coordinates
292,205  292,843
The protein
Catalyzed reaction/ biological activity
triacylglycerol + H2O --> diacylglycerol + fatty acid + H+ (according to UniProt)
Protein family
[wiki|AB hydrolase superfamily] (according to UniPort)
Structure
[PDB|2QXT] [pubmed|18053819]
[PDB|1I6W]
[AF|P37957]
Paralogous protein(s)
[protein|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|lipB]
Expression and Regulation
Operons
genes
[gene|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|lip]
description
[Pubmed|21815947]
regulation
repressed during vegetative growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]) [Pubmed|18840696]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18840696], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
additional information
the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab

[gene|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|lip]

2022-11-21 11:36:11

Bzhu

26

3cf2372641cdd597cec3eebd8d473a87204a1a59

0CE168007FE995D4A6D70A31C5457D3085DAD42A

Biological materials
Mutant
BKE02700 ([gene|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|lip]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATATCCTCCTTTTTTT,  downstream forward: _UP4_TAATGAAAAACAAAACCTTG
BKK02700 ([gene|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|lip]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATATCCTCCTTTTTTT,  downstream forward: _UP4_TAATGAAAAACAAAACCTTG
References
22996591,22267088,23404771,21477088,22246996,23639749,21815947,24402332,15812018,12523966,18721749,12218047,16342303,12951259,11583117,11491291,18383241,19180538,8396026,19883129,18840696,18053819,24827611,12077437,25122499,25495458,26147762,26488405,27003415,27239434,27696241,28050632,18053819,30286107,31553080,32183336,34134054

0DB03F47C7AA45BF52653B1C0B2C5025960C53D7

Page visits: 2529

Time of last update: 2022-12-01 09:15:07

Author of last update: Jstuelk