yscB
168
unknown
locus
BSU_28890
Molecular weight
23.89 kDa
pI
8.06
function
unknown
product
unknown
essential
no
ec
null
synonyms
yscB
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
2,953,795 2,954,460
Phenotypes of a mutant
the mutant forms more heat-resistant spores than the wild type strain [pubmed|32061128]
The protein
Structure
[AF|P94517]
Expression and Regulation
Operons
genes
[gene|0DB2CAEC7B529A3C4369134F086AED16B9963608|yscB]
description
[Pubmed|15033535]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|15033535], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Biological materials
Mutant
MGNA-B014 (yscB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1013 NBRP B. subtilis, Japan]
BKE28890 ([gene|0DB2CAEC7B529A3C4369134F086AED16B9963608|yscB]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCAGGCTCCCTTCT, downstream forward: _UP4_TAAAATAAAAAAAGCCAAGG
BKK28890 ([gene|0DB2CAEC7B529A3C4369134F086AED16B9963608|yscB]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCAGGCTCCCTTCT, downstream forward: _UP4_TAAAATAAAAAAAGCCAAGG
References
Page visits: 2618
Time of last update: 2025-10-24 20:15:49
Author of last update: Jstuelk