SubtiWiki SubtiWiki
yscB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yscB
168

unknown

locus
BSU_28890
Molecular weight
23.89 kDa
pI
8.06
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yscB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,953,795  2,954,460
Phenotypes of a mutant
the mutant forms more heat-resistant spores than the wild type strain [pubmed|32061128]
Expression and Regulation
Operons
genes
[gene|0DB2CAEC7B529A3C4369134F086AED16B9963608|yscB]
description
[Pubmed|15033535]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|15033535], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|0DB2CAEC7B529A3C4369134F086AED16B9963608|yscB]

2021-10-28 15:18:28

ghost

3

028d5003a01e10b3efd65dcb68a166a2484b8369

3C8F0B0E50FEA740DF41C173B5D8CCAC01B734D8

Biological materials
Mutant
MGNA-B014 (yscB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1013 NBRP B. subtilis, Japan]
BKE28890 ([gene|0DB2CAEC7B529A3C4369134F086AED16B9963608|yscB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCAGGCTCCCTTCT,  downstream forward: _UP4_TAAAATAAAAAAAGCCAAGG
BKK28890 ([gene|0DB2CAEC7B529A3C4369134F086AED16B9963608|yscB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCAGGCTCCCTTCT,  downstream forward: _UP4_TAAAATAAAAAAAGCCAAGG
References
15033535,20817675,32061128

0DB2CAEC7B529A3C4369134F086AED16B9963608

Page visits: 754

Time of last update: 2021-12-23 16:07:57

Author of last update: Jstuelk