

similar to NAD(P)H dehydrogenase (quinone)

Molecular weight
23.13 kDa
Protein length
Gene length
resistance to 2-methylhydroquinone
azoR2, yvaB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1182

This gene is a member of the following regulons

3,445,442  3,446,077
The protein
Catalyzed reaction/ biological activity
anthranilate + N,N-dimethyl-1,4-phenylenediamine + 2 NAD+ --> 2-(4-dimethylaminophenyl)diazenylbenzoate + 2 H+ + 2 NADH (according to UniProt)
Protein family
azoreductase type 1 family (with [protein|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|azoR1], according to UniProt)
[PDB|3P0R] (from B. anthracis, 43% identity, 61% similarity)
Paralogous protein(s)
Expression and Regulation
induced by catechol and 2-methylhydroquinone (2-MHQ) ([protein|search|MhqR]) [Pubmed|17725564]
regulatory mechanism
[protein|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]: repression, [Pubmed|17725564], in [regulon|protein:997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|17725564], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab


2022-12-17 09:38:53





Biological materials
MGNA-A444 (yvaB::erm), available at the [ NBRP B. subtilis, Japan]
BKE33540 ([gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTACCAGCCCTTTCG,  downstream forward: _UP4_TAATGAAAAAGCCTCCCCTT
BKK33540 ([gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTACCAGCCCTTTCG,  downstream forward: _UP4_TAATGAAAAAGCCTCCCCTT


Page visits: 2051

Time of last update: 2023-02-05 02:44:07

Author of last update: Melvin.boenninger