leuD

leuD
168

3-isopropylmalate dehydratase (small subunit)

locus
BSU_28250
Molecular weight
22.88 kDa
pI
4.58
Protein length
Gene length
function
biosynthesis of leucine
product
3-isopropylmalate dehydratase (small subunit)
essential
no
ec
4.2.1.33
synonyms
leuD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0066

This gene is a member of the following regulons

Gene
Coordinates
2,888,940  2,889,539
The protein
Catalyzed reaction/ biological activity
(2R,3S)-3-isopropylmalate --> (2S)-2-isopropylmalate (according to UniProt)
Protein family
LeuD family (single member, according to UniProt)
Structure
[PDB|2HCU] (from ''Streptococcus mutans'', 48% identity)
[AF|P94568]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
Expression and Regulation
Operons
genes
[gene|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]-[gene|49E2D2EE480C2FFDED0C35E3AF0DBED5AD819B5F|ilvH]-[gene|EC1CB2FD563EFDA391D13EB8ADFDC8C9734E9D57|ilvC]-[gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA]-[gene|105E3452D7F142A7D7616E35AF3FB753C9B63E38|leuB]-[gene|AC459429A9C50463FD947C1CF9EA919B6FE3B335|leuC]-[gene|0EB4C6EE398B14B9284FFAEDBC26C866CE2070D7|leuD]
description
[Pubmed|1577690]
regulation
expression is stimulated in the presence of glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [PubMed|12193635]
regulatory mechanism
T-box: termination/antitermination, via tRNA controlled [wiki|RNA switch], repression by BCAA, in [regulon|other_regulator:T-box|T-box]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|15547269], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: activation, [Pubmed|12193635], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1577690], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
An [wiki|ncRNA|antisense RNA] is predicted for [gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA] [PubMed|20525796]
the [wiki|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
Open in new tab

[gene|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]→[gene|0EB4C6EE398B14B9284FFAEDBC26C866CE2070D7|leuD]

2023-02-01 13:13:52

Jstuelk

42

905a0fc4b9e1945f65cf0820ea8bda45e4ac716c

931C13BE07545B8037A118810CF4C8E29210A7CE

Other regulations
[protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]: translation repression, [Pubmed|18697947]
Biological materials
Mutant
BKE28250 ([gene|0EB4C6EE398B14B9284FFAEDBC26C866CE2070D7|leuD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAGGTTCCATCTCGCGCA,  downstream forward: _UP4_TGAAAAAGCGGCCGGTATTT
BKK28250 ([gene|0EB4C6EE398B14B9284FFAEDBC26C866CE2070D7|leuD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAGGTTCCATCTCGCGCA,  downstream forward: _UP4_TGAAAAAGCGGCCGGTATTT
References
15060025,12193635,19258532,18697947,8289305,18641142,11948165,15547269,12618455,15547269,12618455,12107147,25157083,20935095,25755103,24163341,26220295

0EB4C6EE398B14B9284FFAEDBC26C866CE2070D7

Page visits: 2817

Time of last update: 2023-02-02 09:33:00

Author of last update: Melvin.boenninger