bacB
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

bacB
168

oxidase that catalyzes the synthesis of 2-oxo-3-(4-oxocyclohexa-2,5-dienyl)propanoic acid, a precursor to L-anticapsin

locus
BSU_37730
Molecular weight
26.69 kDa
pI
5.19
Protein length
Gene length
function
biosynthesis of the antibiotic bacilysin
product
oxidase
essential
no
synonyms
bacB, ywfC, ipa-81d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1917

This gene is a member of the following regulons

Gene
Coordinates
3,872,869  3,873,576
The protein
Catalyzed reaction/ biological activity
synthesis of 2-oxo-3-(4-oxocyclohexa-2,5-dienyl)propanoic acid, a precursor to L-anticapsin [Pubmed|19776011]
3-[(4R)-4-hydroxycyclohexa-1,5-dien-1-yl]-2-oxopropanoate --> 3-[(1E,4R)-4-hydroxycyclohex-2-en-1-ylidene]pyruvate (according to UniProt)
[wiki|Domains]
2 [wiki|cupin 2 domain]s (aa 41 ... 106, aa 151 ... 216)
Structure
[PDB|3H7J] [Pubmed|19776011]
[AF|P39639]
Expression and Regulation
Operons
genes
[gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]-[gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]-[gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]-[gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]-[gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]-[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]
description
[Pubmed|12372825]
regulation
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12372825,21709425], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|12697329,21709425], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|19801406], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|19801406], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]→[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]

2022-07-10 18:45:31

Jstuelk

33

7D644717829C1A41F65E52A4312081846FB55951

33F4BF1A14F6AC22A6ACC7091140A7F012E3837C

Biological materials
Mutant
MGNA-B240 (ywfC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1239 NBRP B. subtilis, Japan]
BKE37730 ([gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37730 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GAAATAAAGCTCCTGCATAT,  downstream forward: _UP4_AAAATGAAGGCGGATGAATG
BKK37730 ([gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37730 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GAAATAAAGCTCCTGCATAT,  downstream forward: _UP4_AAAATGAAGGCGGATGAATG
References
15609023,12372825,21948839,19776011,19801406,20052993,20445239

0EEE23875DB720D256D53F00D1AD5EF24B538B27

Page visits: 2100

Time of last update: 2022-08-16 20:25:35

Author of last update: Melvin.boenninger