SubtiWiki SubtiWiki
yqeB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yqeB
168

unknown

locus
BSU_25740
Molecular weight
27.44 kDa
pI
6.55
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yqeB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,651,632 → 2,652,354
The protein
[wiki|Localization]
membrane protein (according to UniProt)
Expression and Regulation
Operons
genes
[gene|0F202BE8ED62BF5A51BF0A7DFAA5E2DB3D44065E|yqeB]
description
[pubmed|22383849]
Open in new tab

[gene|0F202BE8ED62BF5A51BF0A7DFAA5E2DB3D44065E|yqeB]

2020-11-06 12:56:32

Jstuelk

0

a43a9d03c3470da6e94740e6202bd672105133cc

58DFF1AE5DF90C5F21FB0C378CFD7EC467966F1E

Biological materials
Mutant
BKE25740 (Δ[gene|0F202BE8ED62BF5A51BF0A7DFAA5E2DB3D44065E|yqeB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCACCTTCTTTTTACT,  downstream forward: _UP4_TAACAACAGAGGCTCAAGAA
BKK25740 (Δ[gene|0F202BE8ED62BF5A51BF0A7DFAA5E2DB3D44065E|yqeB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCACCTTCTTTTTACT,  downstream forward: _UP4_TAACAACAGAGGCTCAAGAA

0F202BE8ED62BF5A51BF0A7DFAA5E2DB3D44065E

Page visits: 576

Time of last update: 2022-01-18 21:49:14

Author of last update: Jstuelk