adaA

adaA
168

trigger enzyme

locus
BSU_01810
Molecular weight
24.15 kDa
pI
9.19
Protein length
Gene length
function
adaptive response to alkylative DNA damage
product
trigger enzyme
essential
no
synonyms
adaA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2169

This gene is a member of the following regulons

Gene
Coordinates
203,729  204,364
Phenotypes of a mutant
enhanced formation of [gene|F1969E4C7BAAF70BCBE570F58350C12A3E417539|rpsB] or [gene|144D952B05EBBFF41EC92DF906543EA00475FE69|rpsE] suppressor mutants after mitomycin treatment [pubmed|34339280]
The protein
Catalyzed reaction/ biological activity
methylphosphotriester deoxyribonucleoside in DNA + L-cysteinyl-[protein] --> deoxyribonucleotide in DNA + H+ + S-methyl-L-cysteinyl-[protein] (according to UniProt)
Protein family
[wiki|AraC family]
[wiki|Domains]
[wiki|HTH araC/xylS-type domain] (aa 102-200) (according to UniProt)
Structure
[PDB|1ZGW] (from E. coli, 39% identity) [pubmed|16209950]
[AF|P19219]
Expression and Regulation
Operons
genes
[gene|0F8A564256A598DB3A36668FA0C984542FE1323F|adaA]-[gene|D7E4E4A95CFDB3CFCC7432B08653644AF6876CA1|adaB]
description
[Pubmed|2120677]
regulation
positive control by [protein|search|AdaA] [Pubmed|2120677]
regulatory mechanism
[protein|0F8A564256A598DB3A36668FA0C984542FE1323F|adaA]: activation, in [regulon|protein:0F8A564256A598DB3A36668FA0C984542FE1323F|adaA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2120677], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|0F8A564256A598DB3A36668FA0C984542FE1323F|adaA]→[gene|D7E4E4A95CFDB3CFCC7432B08653644AF6876CA1|adaB]

2022-11-12 21:50:19

ghost

32

216a299d21884eb43084923c354bd4664445d33d

BD6B9F925AA4A09B6EDF781E92DBC11359A0B270

Biological materials
Mutant
BKE01810 ([gene|0F8A564256A598DB3A36668FA0C984542FE1323F|adaA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTCACCTCTCCTT,  downstream forward: _UP4_ATGAGTAAAATGGAGGAAAC
BKK01810 ([gene|0F8A564256A598DB3A36668FA0C984542FE1323F|adaA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTCACCTCTCCTT,  downstream forward: _UP4_ATGAGTAAAATGGAGGAAAC
References
Reviews
22933559,24810496
Original Publications
2120677,8376346,23504016,16209950,34339280

0F8A564256A598DB3A36668FA0C984542FE1323F

Page visits: 1927

Time of last update: 2022-11-28 00:26:47

Author of last update: Jstuelk