yfiU

yfiU
168

similar to multidrug-efflux transporter

locus
BSU_08400
Molecular weight
54.77 kDa
pI
7.61
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfiU

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
914,457  916,013
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|TCR/Tet family] (according to UniProt)
Structure
[AF|O31563]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|0FA2855B04F4977D55FF7BE59E34E4994D0C38F9|yfiU]
description
[pubmed|22383849]
Open in new tab

[gene|0FA2855B04F4977D55FF7BE59E34E4994D0C38F9|yfiU]

2022-11-21 09:01:55

Jstuelk

14

84eccc9828f8bba6469ae38b41c0f0d0d4475cf4

8A8C21497322BDDA4F79BFA85D8869F33D4D8D33

Biological materials
Mutant
MGNA-C308 (yfiU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2306 NBRP B. subtilis, Japan]
BKE08400 ([gene|0FA2855B04F4977D55FF7BE59E34E4994D0C38F9|yfiU]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCGTCAACTCCTTTT,  downstream forward: _UP4_CGTTAAGACCACCCCATCCG
BKK08400 ([gene|0FA2855B04F4977D55FF7BE59E34E4994D0C38F9|yfiU]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCGTCAACTCCTTTT,  downstream forward: _UP4_CGTTAAGACCACCCCATCCG

0FA2855B04F4977D55FF7BE59E34E4994D0C38F9

Page visits: 1230

Time of last update: 2022-12-01 03:57:09

Author of last update: Melvin.boenninger