leuB

leuB
168

3-isopropylmalate dehydrogenase

locus
BSU_28270
Molecular weight
39.79 kDa
pI
4.74
Protein length
Gene length
function
biosynthesis of leucine
product
3-isopropylmalate dehydrogenase
essential
no
ec
1.1.1.85
synonyms
leuB, leuC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0473

This gene is a member of the following regulons

Gene
Coordinates
2,891,020 2,892,117
The protein
Catalyzed reaction/ biological activity
(2R,3S)-3-isopropylmalate + NAD+ --> 4-methyl-2-oxopentanoate + CO2 + NADH (according to UniProt)
Protein family
Isocitrate and isopropylmalate dehydrogenases family (with [protein|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd] and [protein|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|ycsA], according to UniProt)
Structure
[PDB|1XAD] (Thermus thermophilus)
[AF|P05645]
Modification
phosphorylated on Arg-4 [Pubmed|22517742]
Paralogous protein(s)
[protein|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|ycsA]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]-[gene|49E2D2EE480C2FFDED0C35E3AF0DBED5AD819B5F|ilvH]-[gene|EC1CB2FD563EFDA391D13EB8ADFDC8C9734E9D57|ilvC]-[gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA]-[gene|105E3452D7F142A7D7616E35AF3FB753C9B63E38|leuB]-[gene|AC459429A9C50463FD947C1CF9EA919B6FE3B335|leuC]-[gene|0EB4C6EE398B14B9284FFAEDBC26C866CE2070D7|leuD]
description
[Pubmed|1577690]
regulation
expression is stimulated in the presence of glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [PubMed|12193635]
regulatory mechanism
T-box: termination/antitermination, via tRNA controlled [wiki|RNA switch], repression by BCAA, in [regulon|other_regulator:T-box|T-box]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|15547269], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: activation, [Pubmed|12193635], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1577690], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
An [wiki|ncRNA|antisense RNA] is predicted for [gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA] [PubMed|20525796]
the [wiki|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
Open in new tab

[gene|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]→[gene|0EB4C6EE398B14B9284FFAEDBC26C866CE2070D7|leuD]

2022-11-18 22:44:43

Jstuelk

35

905a0fc4b9e1945f65cf0820ea8bda45e4ac716c

931C13BE07545B8037A118810CF4C8E29210A7CE

Biological materials
Mutant
1A618 ( ''leuB''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A618&Search=1A618 BGSC]
BKE28270 ([gene|105E3452D7F142A7D7616E35AF3FB753C9B63E38|leuB]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTTAACCGTTCTCCTTT, downstream forward: _UP4_TGACAGCTTACGTTAAGCGG
BKK28270 ([gene|105E3452D7F142A7D7616E35AF3FB753C9B63E38|leuB]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTTAACCGTTCTCCTTT, downstream forward: _UP4_TGACAGCTTACGTTAAGCGG
References
15060025,12193635,19258532,8289305,18641142,22517742,15547269,12618455,12107147,20935095,25157083,24163341,25755103,15378759,26220295

105E3452D7F142A7D7616E35AF3FB753C9B63E38

Page visits: 2380

Time of last update: 2022-11-28 22:39:23

Author of last update: Melvin.boenninger