sasA

sasA
168

(p)ppGpp synthetase, small alarmone synthetase, contributes to cellular heterogeneity in protein synthesis during nutrient limitation

locus
BSU_38480
Molecular weight
24.45 kDa
pI
6.22
Protein length
Gene length
function
ppGpp synthesis independent from stringent response
product
(p)ppGpp synthetase
essential
no
synonyms
sasA, ywaC, relP, ipa-7d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2357

This gene is a member of the following regulons

Gene
Coordinates
3,949,952  3,950,584
Phenotypes of a mutant
a [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] triple mutant requires branched chain amino acids, methionine and threonine for growth, the requirement can be suppressed by reduced expression of [gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA] or inactivation of [gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY] [Pubmed|24163341]
a [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] triple mutant acquires suppressor mutations in [gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA], [gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA], [gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk] or inactivation of [gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY] [Pubmed|24682323,24163341]
The protein
Catalyzed reaction/ biological activity
ATP + GTP --> AMP + guanosine 3'-diphosphate 5'-triphosphate (according to UniProt)
Protein family
RelA/SpoT family (with [protein|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] and [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel], according to UniProt)
[wiki|Domains]
single ppGpp synthetase domain [Pubmed|24163341]
Structure
[PDB|6FGK] [Pubmed|29391580]
[AF|P39583]
Paralogous protein(s)
[protein|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]
Expression and Regulation
Operons
genes
[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]
description
[Pubmed|11866510]
regulation
expression is reduced in a [protein|search|SigV] mutant [Pubmed|21926231]
regulatory mechanism
[protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]: repression, [pubmed|31723135], in [regulon|protein:7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR regulon]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421,11866510,18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV]: sigma factor, in [regulon|protein:D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV regulon]
Open in new tab

[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]

2022-12-08 15:59:56

ghost

34

f17af893898b6ac5a68aded1540d658a9e68846f

AF67209B63B2051404486A22A1851069422C37F6

Biological materials
Mutant
GP3470 (Δ[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]::spec Δ[gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]::phleo), available in [wiki|Jörg Stülke]'s lab
GP3471 (Δ[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]::spec Δ[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]::cat), available in [wiki|Jörg Stülke]'s lab
GP3424 (Δ[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]::spec), available in [wiki|Jörg Stülke]'s lab
MGNA-B218 (ywaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1217 NBRP B. subtilis, Japan]
GP2066 (''[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]::mls''), available in [wiki|Jörg Stülke]'s lab
BKE38480 ([gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCGTCATCTCCTTTA,  downstream forward: _UP4_TAAAAAAGACGGCACCCAAG
BKK38480 ([gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCGTCATCTCCTTTA,  downstream forward: _UP4_TAAAAAAGACGGCACCCAAG
Expression vectors
pGP3451 (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in [wiki|Jörg Stülke]'s lab
pGP3456: expression of Strep-[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] by [wiki|pGP380] in B. subtilis suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP3457: expression of [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]-Strep by [wiki|pGP382] in B. subtilis suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
GP3692 (based on [wiki|pAC7]), available in [wiki|Jörg Stülke]'s lab
References
Reviews
27149325,30980074
Original Publications
29391580,21926231,22950019,18670626,19447912,18067544,19477419,12207695,11866510,18179421,24163341,24489751,24687489,24682323,26460002,27875634,31723135,35594298

1107A963C253FBEE8716507BD0EC0E7CD5642B12

Page visits: 4151

Time of last update: 2022-12-07 11:24:12

Author of last update: Jstuelk