SubtiWiki SubtiWiki
abn2
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

abn2
168

endo-1,5-alpha-L-arabinosidase

locus
BSU_39330
Molecular weight
52.38 kDa
pI
7.37
Protein length
Gene length
function
arabinan degradation
product
endo-1,5-alpha-L-arabinosidase
essential
no
ec
null
synonyms
abn2, yxiA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3507

This gene is a member of the following regulons

Gene
Coordinates
4,039,466  4,040,875
The protein
Catalyzed reaction/ biological activity
Endohydrolysis of (1->5)-alpha-arabinofuranosidic linkages in (1->5)-arabinans (according to UniProt)
Protein family
[wiki|glycosyl hydrolase 43 family] (according to UniProt)
[wiki|Domains]
N-terminal catalytic domain with a characteristic -propeller fold and a C-terminal domain whose function is unknown  [Pubmed|24549757]
[wiki|Cofactors]
Ca2+ [Pubmed|24549757]
Structure
[PDB|2X8F] [Pubmed|20883454]
Kinetic information
With linear-alpha-1,5-l-arabinan as the preferred substrate, the enzyme exhibited an apparent K(m) of 2.0 mg ml(-1) and V(max) of 0.25 mmol min(-1) mg(-1) at pH 7.0 and 50C. [Pubmed|18408032]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862,18408032]
Expression and Regulation
Operons
genes
[gene|1130F1D4CBDDF7B8FFCAF929B8BC4D283233679A|abn2]
description
[Pubmed|18408032]
regulation
expression is stimulated by arabinose and pectin and repressed by glucose [Pubmed|18408032]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, unknown [Pubmed|18408032], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|18408032], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|1130F1D4CBDDF7B8FFCAF929B8BC4D283233679A|abn2]

2021-09-18 05:52:58

ghost

5

0557ccfff76daf35b1b49d0abf10628135054232

5F9EC005FF85515ADA30270E72B92A5C570B0DEA

Biological materials
Mutant
MGNA-B716 (yxiA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1715 NBRP B. subtilis, Japan]
BKE39330 ([gene|1130F1D4CBDDF7B8FFCAF929B8BC4D283233679A|abn2]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTAAACAATTCGCCTCT,  downstream forward: _UP4_TAAGATGGAGAAGCGCCTTC
BKK39330 ([gene|1130F1D4CBDDF7B8FFCAF929B8BC4D283233679A|abn2]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTAAACAATTCGCCTCT,  downstream forward: _UP4_TAAGATGGAGAAGCGCCTTC
labs
[http://www.itqb.unl.pt/research/biology/microbial-genetics [Isabel de Sa-Nogueira]], Lisboa, Portugal [homepage]
References
18607095,24549757,18408032,18957862,12850135,18408032,20883454

1130F1D4CBDDF7B8FFCAF929B8BC4D283233679A

Page visits: 1787

Time of last update: 2021-09-18 05:52:54

Author of last update: Melvin.boenninger