rplGB

rplGB
168

highly expressed protein, similar to ribosomal protein L7AE family, associated with the ribosome during exponential growth, binds K-turns in RNA switches

locus
BSU_01090
Molecular weight
8.33 kDa
pI
9.51
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ybxF, ybaB, rpmXB, ktuS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1358

This gene is a member of the following regulons

Gene
Coordinates
129,340  129,588
The protein
Catalyzed reaction/ biological activity
binds K-turns in [wiki|RNA switch]es as they occur in the [protein|search|L-box], the [protein|search|S-box] and the [protein|search|T-box] [Pubmed|22355167]
Protein family
Eukaryotic ribosomal protein eL8 family (with [protein|7BFA65857F69855DBB3BB64D93B4ED2F09DC705B|rplGA], according to UniProt)
Structure
[PDB|3V7E] ([protein|11D7ABA61FC4069B48614875AF2C6C694291B545|rplGB] bound to the [[S-box|SAM-I riboswitch]] aptamer) [Pubmed|22355167]
[AF|P46350]
[wiki|Localization]
cytoplasm (according to UniProt)
Expression and Regulation
Operons
genes
[gene|11D7ABA61FC4069B48614875AF2C6C694291B545|rplGB]-[gene|0E4CB387626F53E5F60C7639D525B57D50C65C03|rpsL]-[gene|8049CACE85B2627A08CB4D8A8587D52E2DB24C7F|rpsG]-[gene|297844645CCCF40CB40E84339997F6610883DF4E|fusA]-[gene|E771685D6D41D48E0C0AF77F15B4F380820FCDC2|tufA]
description
[pubmed|22383849]
regulation
[protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
the mRNA is processed between [gene|11D7ABA61FC4069B48614875AF2C6C694291B545|rplGB] and [gene|0E4CB387626F53E5F60C7639D525B57D50C65C03|rpsL] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex [Pubmed|29794222]
regulatory mechanism
stringent response: negative regulation, [pubmed|11948165], in [regulon|other_regulator:stringent response|stringent response]
Open in new tab

[gene|11D7ABA61FC4069B48614875AF2C6C694291B545|rplGB]->[gene|E771685D6D41D48E0C0AF77F15B4F380820FCDC2|tufA]

2022-11-22 21:53:30

Jstuelk

40

d846304cc2bd15e30cde627ac53b7d142c24fbb5

614BD7852C60161107389373FB106F44BAE4C835

Biological materials
Mutant
BKE01090 ([gene|11D7ABA61FC4069B48614875AF2C6C694291B545|rplGB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAACATATCCTCCAAAG,  downstream forward: _UP4_TAACGTACTTTTGTTTTTGC
BKK01090 ([gene|11D7ABA61FC4069B48614875AF2C6C694291B545|rplGB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAACATATCCTCCAAAG,  downstream forward: _UP4_TAACGTACTTTTGTTTTTGC
References
11948165,23249744,22355167,26522935,29280348,29794222

11D7ABA61FC4069B48614875AF2C6C694291B545

Page visits: 2276

Time of last update: 2022-12-02 02:52:31

Author of last update: Jstuelk