SubtiWiki SubtiWiki
yidC2

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yidC2
168

Sec-independent membrane protein translocase, required for development of genetic competence

locus
BSU_23890
Molecular weight
30.60 kDa
pI
9.9
Protein length
Gene length
function
membrane insertion of proteins and protein secretion
product
Sec-independent membrane protein translocase
essential
no
synonyms
yidC2, yqjG, oxaAB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0706

This gene is a member of the following regulons

Gene
Coordinates
2,483,904  2,484,731
The protein
Protein family
OXA1/ALB3/YidC family (with [protein|D40C202E67A5319A91811DB11356F47A56C97DD2|yidC1], according to UniProt) [Pubmed|20800571,21194367,15802250]
Structure
[PDB|3WO6] (from ''Bacillus halodurans'', 41% identity) [Pubmed|24739968]
Paralogous protein(s)
[protein|D40C202E67A5319A91811DB11356F47A56C97DD2|yidC1], one of the two proteins has to be present for viability [Pubmed|17114254]
[wiki|Localization]
membrane [Pubmed|22864117]
Expression and Regulation
Operons
genes
[gene|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM]-[gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]
description
[Pubmed|22383849]
regulation
repressed by large amounts of [wiki|SpoIIIJ], induced by small amounts of [wiki|SpoIIIJ] ([protein|search|MifM]) [Pubmed|19779460]
regulatory mechanism
[protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM]: attenuation, an mRNA hairpin of the yqjG transcript unfold upon translation arrest of [protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM] at decreased [protein|D40C202E67A5319A91811DB11356F47A56C97DD2|yidC1] levels, in [regulon|protein:C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM regulon]
additional information
An antisense RNA is predicted for '[protein|search|mifM]' [PubMed|20525796]
Open in new tab

[gene|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM]→[gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]

2022-01-28 10:51:47

ghost

10

f8a6fff082045f34969fcbb9e7dd06a79ebdd148

CF4B91E771854E675A6B5052E8B77F0D2D86EFB9

Biological materials
Mutant
MGNA-C389 (yqjG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2387 NBRP B. subtilis, Japan]
BKE23890 ([gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTTTGTTCTCCTCCTTT,  downstream forward: _UP4_TAAAAAAGCAACCCCGTGCA
BKK23890 ([gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTTTGTTCTCCTCCTTT,  downstream forward: _UP4_TAAAAAAGCAACCCCGTGCA
References
Reviews
22688815,20800571,21194367,15802250,25947384,27879020
Original Publications
17114254,15995216,11889108,12586834,19717609,19779460,21204254,22383849,22864117,24443530,25313395,25359772,25855636,25903689,26023232,24739968,26331454

121A9543F5BC1CBE77D85A34099DE09F8AC63E9F

Page visits: 1925

Time of last update: 2022-01-26 10:40:33

Author of last update: Melvin.boenninger